BioMed Research International

BioMed Research International / 2021 / Article
Special Issue

Animal Models of Human Pathology 2020

View this Special Issue

Research Article | Open Access

Volume 2021 |Article ID 8851888 | https://doi.org/10.1155/2021/8851888

Xiulin Zhang, Yang He, Wei Zhang, Yining Wang, Xinmeng Liu, Aique Cui, Yidi Gong, Jing Lu, Xin Liu, Xueyun Huo, Jianyi Lv, Meng Guo, Xiaoyan Du, Lingxia Han, Hongyan Chen, Jilan Chen, Changlong Li, Zhenwen Chen, "Development of Microsatellite Marker System to Determine the Genetic Diversity of Experimental Chicken, Duck, Goose, and Pigeon Populations", BioMed Research International, vol. 2021, Article ID 8851888, 14 pages, 2021. https://doi.org/10.1155/2021/8851888

Development of Microsatellite Marker System to Determine the Genetic Diversity of Experimental Chicken, Duck, Goose, and Pigeon Populations

Academic Editor: Monica Fedele
Received10 Sep 2020
Revised09 Dec 2020
Accepted05 Jan 2021
Published15 Jan 2021

Abstract

Poultries including chickens, ducks, geese, and pigeons are widely used in the biological and medical research in many aspects. The genetic quality of experimental poultries directly affects the results of the research. In this study, following electrophoresis analysis and short tandem repeat (STR) scanning, we screened out the microsatellite loci for determining the genetic characteristics of Chinese experimental chickens, ducks, geese, and pigeons. The panels of loci selected in our research provide a good choice for genetic monitoring of the population genetic diversity of Chinese native experimental chickens, ducks, geese, and ducks.

1. Introduction

Laboratory animals are important experimental materials for science research. They play key roles in the investigation of pathogenesis, diagnosis of diseases, pharmaceutical research, and other fields [1]. The genetic quality of laboratory animals directly affects the accuracy, repeatability, and scientificity of medical biological research results. Genetic monitoring is one of the effective methods to evaluate population’s genetic diversity. Through genetic monitoring, whether genetic mutations and genetic pollution occurred can be analyzed.

Poultry, including chicken, duck, goose, and pigeon, has become commonly used laboratory animals [2]. They are easy to reproduce and hatch in vitro. Among them, chickens are the most widely used poultry in life science research [3, 4]. Ducks, geese, and pigeons also play important roles in the research of epidemiology, immunology, virology, and pharmacotoxicology [59]. There are many genetic analysis and quality control methods applied to chickens [10, 11]. However, at present, we find few reports about the genetic analysis systems and quality control methods of duck, goose, and pigeon populations, especially in the Chinese native groups.

Hence, in this study, we screened out the microsatellite loci with uniform distribution, stable amplification, and rich polymorphism in experimental chickens, ducks, geese, and pigeons with different genetic backgrounds [12]. We developed effective microsatellite marker systems to determine the genetic diversity of experimental chickens, ducks, geese, and pigeons, which will lay the foundation for the genetic quality control of them and promote the application of experimental poultry.

2. Materials and Methods

2.1. Animal Sample

Three outbred groups and three haplotype groups of experimental chicken were used in this research: outbred group BWEL-SPF chickens ((SCXK (black) 2017-005)), 40 samples, 37 weeks old, 6 males and 34 females, which has been closed for 20 generations; outbred group BM chicken (from BWEL chicken lineage (SCXK (black) 2017-005)), 40 samples, 14 weeks old, 6 males and 34 females; outbred group Beijing oil chickens, 46 samples. MHC haplotype chickens were bred from the 13th generation of BWEL chicken, the haplotype was continuously selected based on the MHC core genes, and the half-sibling or sibling mating method was used to breed to the 8th generation [13]. We selected 5 G1 haplotype chickens, 53 weeks old, 1 male and 4 females; 5 G2 haplotype chickens, 93 weeks, 1 male and 4 females; and 5 G7 haplotype chickens, 82 weeks, 1 male and 4 females. The Beijing oil chickens came from the Institute of Animal Science (IAS), Chinese Academy of Agricultural Sciences (CAAS). Other samples were from Harbin Veterinary Research Institute (HVRI), CAAS. All the samples were blood.

Two outbred groups and four haplotype groups of experimental duck (bred from Jinding (JD) duck lineage (SCXK (black) 2017-006)) were selected: outbred group 1, 40 samples, 37 weeks old, 6 males and 34 females; outbred group JD duck, 40 samples, 37 weeks old, 6 males and 34 females; 10 A haplotype ducks, 53 weeks old, 1 male and 4 females; 10 B haplotype ducks, 53 weeks old, 1 male and 4 females; 10 C haplotype ducks, 53 weeks old, 1 male and 4 females; 10 D haplotype ducks, 53 weeks old, 1 male and 4 females. All the samples are duck muscle tissue and were from HVRI, CAAS.

We collected two outbred groups of experimental geese: outbred group Guangdong Wuzong goose, 44 samples, 37 weeks old, 6 males and 34 females; outbred group Yangzhou goose, 44 samples, 37 weeks old, 6 males and 34 females. All the samples are goose liver tissue. Guangdong Wuzong geese were from Southern Medical University, and Yangzhou geese were from Yangzhou University.

Forty pigeons were randomly selected from two populations of white king pigeons and silver king pigeons, half male and half female, with no age limit. All the animals were from Liujinlong pigeon farms in Beijing. Their heart tissues were collected.

All breeding is carried out in accordance with Chinese agricultural standards NY/T 1901. What is more, all experiments followed the 3R principle.

2.2. Microsatellite Locus Selection

By searching PubMed and using SSR Hunter software to analyze animal gene information, we obtained microsatellite loci for further screening.

2.3. DNA Extraction

Phenol-chloroform extraction method was used to extract DNA from muscle, liver, and heart tissue. TIANamp Blood DNA Kits (Tiangen, Beijing, China) were used to extract DNA from chicken blood samples. All DNA concentrations were diluted to 50 ng/μL, stored in -20°C.

2.4. PCR Procedure and Agarose Gel Electrophoresis

The PCR was performed in a 20 μL reaction volume containing 10 μL Dream Taq Green PCR Master Mix (Thermo Fisher Scientific, Massachusetts, MA), 2 μL pure water (ddH2O), 10 pmol each primer, and 50 ng of the extracted DNA template. The PCR protocol was as follows: 94°C for 5 min, followed by 35 cycles of 94°C for 30 s, suitable temperature for 30 s, 72°C for 30 s, and a final extension at 72°C for 5 min. Amplified products were stored at -20°C for further analysis.

Amplified products were electrophoresed on a 2% agarose gel at 130 V, 90 min.

2.5. STR Scanning

We performed STR scanning on PCR amplification products of candidate loci. The forward primers of candidate microsatellite loci were fluorescent labelled with FAM, HEX, and TAMRA. The sample genome was amplified with fluorescent primers, and the amplified products were scanned by STR through 3730xl DNA Analyzer (Applied Biosystems, Thermo Fisher Scientific, Massachusetts, USA). All the STR scanning was performed by Beijing Tianyi Huiyuan Biotechnology Co., Ltd.

2.6. Data Analysis

GeneMarker V2.2.0 software was used to analyze the length of amplified fragments from different populations at each microsatellite locus. Popgene 3.2 software was used to analyze the observed number of alleles, effective number of alleles, Shannon’s information index, and effective heterozygosity of microsatellite loci. The polymorphic information content of multiple sites was calculated using PIC calculation software (PIC_CALC.0.6).

3. Results

3.1. Microsatellite Locus Selection
3.1.1. Preliminary Screening of Microsatellite Loci by PCR

Firstly, we obtained the microsatellite locus information of experimental chickens, ducks, geese, and pigeons by searching previous reports on PubMed and using the SSR Hunter software to analyze the genetic information of different populations [14, 15]. We collected 72, 59, 57, and 61 microsatellite loci of experimental chicken, duck, goose, and pigeon, respectively.

In order to clarify the amplification conditions of the microsatellite loci and exclude the loci with poor specificity, we performed temperature gradient PCR and agarose gel electrophoresis of microsatellite loci. Then, we performed PCR amplification on the most suitable conditions and subjected the PCR products to agarose gel electrophoresis to screen out loci with suitable length, good polymorphism in outbred groups, good monomorphism in haplotypes, and high specificity. Taking the chicken GGNCAMZO locus and duck AY264 locus as example, the results are shown in Figure 1. GGNCAMZO locus is monomorphic in the haplotype chicken population, and AY264 locus is polymorphic in the outbred duck group.

In summary, we selected 37 and 32 microsatellite loci with good polymorphism in the outbred groups and haplotypes of chicken, respectively [12, 16, 17]. In addition, 15 and 23 loci were screened in the outbred groups and haplotypes of duck, respectively [14, 18, 19]. In the outbred groups of goose and pigeon, 14 and 20 microsatellite loci were chosen [18, 2023]. Loci in these panels would be candidate for the final microsatellite marker evaluation systems.

3.1.2. STR Scanning Analysis

In order to further complete the microsatellite marker system, we performed STR scanning on the candidate microsatellite DNA loci matched microsatellite criteria and analyzed the length of the amplified product at the peak with GeneMarker software (V1.75). Taking the UU-CliμT47 locus as an example, it showed polymorphism in the outbred group of pigeon (Figure 2).

We finally determined that in experimental chickens, 28 loci were selected for genetic monitoring in the outbred groups and 14 loci for haplotypes. All microsatellite DNA loci are shown in Table 1. There are 13 common loci.


LociPrimer sequence (5-3)Temperature(°C)Allele rangeApplicable groups

MCW0029GTGGACACCCATTTGTACCCTATG63.8139-188Outbred group
CATGCAATTCAGGACCGTGCA
ADL0293GTAATCTAGAAACCCCATCT53.9106-120Outbred group
ACATACCGCAGTCTTTGTTC
ADL0317AGTTGGTTTCAGCCATCCAT58.5177-219Outbred group
CCCAGAGCACACTGTCACTG
GCT0016TCCAAGGTTCTCCAGTTC52.2111-148Outbred group
GGCATAAGGATAGCAACAG
ADL0304GGGGAGGAACTCTGGAAATG53.9138-161Outbred group
CCTCATGCTTCGTGCTTTTT
LEI0074GACCTGGTCCTGACATGGGTG58.5221-243Outbred group
GTTTGCTGATTAGCCATCGCG
ADL328CACCCATAGCTGTGACTTTG53.9107-120Outbred group
AAAACCGGAATGTGTAACTG
GGANTEClGCGGGGCCGTTATCAGAGCA65.0139-194Outbred group
AGTGCAGGGCGCTCCTGGT
LEI094CAGGATGGCTGTTATGCTTCCA56.0176-211Outbred group
CACAGTGCAGAGTGGTGCGA
MCW0330TGGACCTCATCAGTCTGACAG58.5217-287Outbred group
AATGTTCTCATAGAGTTCCTGC
LEI0141CGCATTTGATGCATAACACATG52.2221-245Outbred group
AAGGCAAACTCAGCTGGAACG
MCW0087ATTTCTGCAGCCAACTTGGAG58.5268-289Outbred group
CTCAGGCAGTTCTCAAGAACA
MCW0347GCTTCCAGATGAGCTCCATGG52.0121-149Outbred group
CACAGCGCTGCAGCAACTG
ADL176TTGTGGATTCTGGTGGTAGC58.5183-200Outbred group
TTCTCCCGTAACACTCGTCA
ADL0201GCTGAGGATTCAGATAAGAC58.5111-151Outbred group
AATGGCYGACGTTTCACAGC
GGNCAMZOGTCACTAGGTTAGCAGCATG56.0234Outbred group
GCTGGATACAGACCTCGATTHaplotype
GGAVIRAGAGATGGTGCACGCAACCT60.786-89Outbred group
CGAGCACTTTCTGGCAGAGAHaplotype
MCW0063GGCTCCAAAAGCTTGTTCTTAGCT53.9116-146Outbred group
GAAAACCAGTAAAGCTTCTTACHaplotype
ADL185CATGGCAGCTGACTCCAGAT58.5116-142Outbred group
AGCGTTACCTGTTCGTTTGCHaplotype
GGMYCCGAGGCGCTCTGCGAGTTTA62.4139-151Outbred group
TGGGGACCTCTGGCTCTGACHaplotype
LEI0094GATCTCACCAGTATGAGCTGC53.9250-283Outbred group
TCTCACACTGTAACACAGTGCHaplotype
GGVITCAGCCATCATTCAGGGCATCT58.586Outbred group
GATGTCCTGAGTGATGCTCAHaplotype
ADL0292CCAAATCAGGCAAAACTTCT58.5110-136Outbred group
AAATGGCCTAAGGATGAGGAHaplotype
GGVITIIGGGCAGGTTTCTAATGCCTGA56.0186-189Outbred group
CCCATCGTTTCAACTGTATGHaplotype
ADL166TGCCAGCCCGTAATCATAGG58.5131-154Outbred group
AAGCACCACGACCCAATCTAHaplotype
MCW0014AAAATATTGGCTCTAGGAACTGTC58.5172-195Outbred group
ACCGGAAATGAAGGTAAGACTAGCHaplotype
GGCYMAAGCGAGGCGCTCTGCGAGTT64.6140-153Outbred group
GGGCACCTCTGGCTCTGACCHaplotype
MCW0402ACTGTGCCTAGGACTAGCTG56.0141-229Outbred group
CCTAAGTCTGGGCTCTTCTGHaplotype
STMSGGHU2-1ACTTAATATGTGTGAGGTGGC53.9235-238Haplotype
GTTCTCACAATTGCATTAGC

In experimental duck populations, we chose 25 loci and 15 loci for genetic monitoring in the outbred duck groups and haplotype groups. There are 12 common loci. Microsatellite loci are shown in Table 2.


LociPrimer sequence(5-3)Temperature (°C)Allele rangeApplicable groups

CAUD007ACTTCTCTTGTAGGCATGTCA60.8100-190Outbred group
CACCTGTTGCTCCTGCTGT
CAUD004TCCACTTGGTAGACCTTGAG60.8234-385Outbred group
TGGGATTCAGTGAGAAGCCT
CAUD023CACATTAACTACATTTCGGTCT51.4163-234Outbred group
CAGCCAAAGAGTTCAACAGG
CAUD027AGAAGGCAGGCAAATCAGAG66.070-180Outbred group
TCCACTCATAAAAACACCCACA
CAUD001ACAGCTTCAGCAGACTTAGA55.5150-247Outbred group
GCAGAAAGTGTATTAAGGAAG
CAUD031AGCATCTGGACTTTTTCTGGA51.4107-187Outbred group
CACCCCAGGCTCTGAGATAA
CAUD032GAAACCAACTGAAAACGGGC58.196-206Outbred group
CCTCCTGCGTCCCAATAAG
AY314CTCATTCCAATTCCTCTGTA50.3112-329Outbred group
CAGCATTATTATTTCAGAAGG
CMO211GGATGTTGCCCCACATATTT55.0112-205Outbred group
TTGCCTTGTTTATGAGCCATT
APH09GGATGTTGCCCCACATATTT58.0134-190Outbred group
TTGCCTTGTTTATGAGCCATTA
APH11GGACCTCAGGAAAATCAGTGTA58.5183-185Outbred group
GCAGGCAGAGCAGGAAATA
APL2GATTCAACCTTAGCTATCAGTCTCC58.5115-125Outbred group
CGCTCTTGGCAAATGTCC
CAUD011TGCTATCCACCCAATAAGTG50.3145-223Outbred group
CAAAGTTAGCTGGTATCTGC
CAUD006ATGGTTCTCTGTAGGCAATC63.5183-290Outbred group
TTCTGCTTGGGCTCTTGGAHaplotype
CAUD018TTAGACAAATGAGGAAATAGTA50.3100-180Outbred group
GTCCAAACTAAATGCAGGCHaplotype
CAUD010GGATGTGTTTTTCATTATTGAT50.3138-200Outbred group
AGAGGCATAAATACTCAGTGHaplotype
CAUD012ATTGCCTTTCAGTGGAGTTTC63.5182-286Outbred group
CGGCTCTAAACACATGAATGHaplotype
CAUD014CACAACTGACGGCACAAAGT58.1136-200Outbred group
CTGAGTTTTTCCCGCCTCTAHaplotype
CAUD034TACTGCATATCACTAGAGGA55.5160-296Outbred group
TAGGCATACTCGGGTTTAGHaplotype
CAUD035GTGCCTAACCCTGATGGATG63.5174-282Outbred group
CTTATCAGATGGGGCTCGGAHaplotype
APL579ATTAGAGCAGGAGTTAGGAGAC55.0116-227Outbred group
GCAAGAAGTGGCTTTTTTCHaplotype
AY258ATGTCTGAGTCCTCGGAGC58.189-162Outbred group
ACAATAGATTCCAGATGCTGAAHaplotype
CMO212CTCCACTAGAACACAGACATT58.0186-272Outbred group
CATCTTTGGCATTTTGAAGHaplotype
CAUD028TACACCCAAGTTTATTCTGAG55.5152-226Outbred group
ACTCTCCAGGGCACTAGGHaplotype
CAUD026ACGTCACATCACCCCACAG60.8134-196Outbred group
CTTTGCCTCTGGTGAGGTTCHaplotype
APH18TTCTGGCCTGATAGGTATGAG58.0178-325Haplotype
GAATTGGGTGGTTCATACTGT
CAUD002CTTCGGTGCCTGTCTTAGC60.8200-231Haplotype
AGCTGCCTGGAGAAGGTCT
CAUD005CTGGGTTTGGTGGAGCATAA60.8184-290Haplotype
TACTGGCTGCTTCATTGCTG

14 microsatellite loci with good polymorphism were considered as microsatellite markers in the outbred group of goose. Table 3 demonstrates the number of alleles, optimal amplification conditions, and fragment length of 14 alleles for the outbred experiment geese.


LociPrimer sequence(5-3)Temperature (°C)Allele range

G-Ans17ACAAATAACTGGTTCTAAGCAC51.0111–123
AGAGGACTTCTATTCATAAATA
G-TTUCG1CCCTGCTGGTATACCTGA53.0113-115
GTGTCTACACAACAGC
G-APH13CAACGAGTGACAATGATAAAA53.0163-165
CAATGATCTCACTCCCAATAG
G-Ans02TTCTGTGCAGGGGCGAGTT58.0202–230
AGGGAACCGATCACGACATG
G-Ans07GACTGAGGAACTACAATTGACT62.0236–246
ACAAAGACTACTACTGCCAAG
G-Ans18GTGTTCTCTGTTTATGATATTAC56.0229–237
AACAGAATTTGCTTGAAACTGC
G-Ans25CACTTATTAATGGCACTTGAAA62.0261–277
GTTCTCTTGTCACAACTGGA
G-Hhiμ1bATCAAAGGCACAATGTGAAAT60.0212–216
AGTAAGGGGGCTTCCACC
G-CKW47AACTTCTGCACCTAAAAACTGTCA56.0213-215
TGCTGAGGTAACAGGAATTAAAA
G-Bcaμ5AGTGTTTCTTTCATCTCCACAAGC56.0197-201
AGACCACAATCGGACCACATATTC
G-Bcaμ7TAGTTTCTATTTGCACCCAATGGAG60.0171-175
CGGTCCTGTCCTTGTGCTGTAA
G-Bcaμ8CCCAAGACTCACAAAACCAGAAAT58.0155-159
ATGAAAGAAGAGTTAAACGTGTGCAA
G-CAUD006ATGGTTCTCTGTAGGCAATC56.0170-210
TTCTGCTTGGGCTCTTGGA
G-APH20ACCAGCCTAGCAAGCACTGT53.0140-150
GAGGCTTTAGGAGAGATTGAAAAA

In the outbred group of pigeon, we finally screened out 16 microsatellite loci with good polymorphism, several alleles, and typical stutter peaks. All microsatellite locus information is shown in Table 4.


LociPrimer sequence(5-3)Temperature (°C)Allele range

UU-Cli02TGGGCAAGGTACACTTTTAGGT61.0158-170
CTTTATGCTCCCCCTTGAGAT
UU-Cli06TTTGAAAAACATGGATTGTGC56.0140-145
AATTTGCAGAGGGTGAGTGG
PG5GTTCTTGGTGTTGCATGGATGC59.0262-266
AGTTACGAAATGATTGCCAGAAG
C26L9(1265223)CAAAGCTGCTGACGTGAATCAA59.0467-472
AGAGACGCTCCATGCAAAAG
UU-Cli14CAGAACGTTTTGTTCTGTTTGG58.0265-292
TCTTGCTGCAGTCTTCATCC
C12L1(532572)GTTGTTTGGCTGAGTGGACG62.0126-136
TCAACCAGGGGAATTGGCAG
C12L4(906353)GCTGCTGTCTTCTTCATTGGG60.0210-250
TTAAAACCTCCCGTCTCCCTG
CliμD11CCAATCCCAAAGAGGATTAT58.078-98
ACTGTCCTATGGCTGAAGTG
C26L10(1404758)GCTGTCAGGTATCAGCCACAA59.0211-226
TCAGACCCACGAAAGCTGTAA
C26L4(568923)CAACCCCATGTGGGTGAGAC63.0357-432
CACCACCACGTGGGACATC
PG4CCCATCTCCTGCCTGATGC64.0136-170
CACAGCAGGATGCTGCCTGC
UU-Cli12CGCCAGACTGTATTGTGAGC61.0231-265
AGCATGGCTGTTCTTTGAGG
CliμT47ATGTGTGTTTGTGCATGAAG56.0183-214
ATGAAAGCCTGTTAGTGGAA
CliμD32GAGCCATTTCAGTGAGTGACA60.0136-158
GTTTGCAGGAGCGTGTAGAGAAGT
UU-Cli07GCTGCCTGTTACTACCTGAGC61.0277-310
CTGGCCATGAAATGAACTCC
C26L1(20390)AGGAGCCTACACTGGGTTTTC60.0250-268
TGTAGCTCTGCAATCAGCCT

3.1.3. Analysis of Population Microsatellite Loci

We inputted the results of STR scanning into Popgene 3.2 to analyze experimental chicken in the outbred groups and the haplotypes at 29 loci. In the outbred groups, 28 microsatellite loci show a high degree of polymorphism, and the average number of observed alleles is 4.571. The average number of effective alleles is 3.270, and the average Shannon’s information index is 1.198 (Table 5). Furthermore, the average effective heterozygosity is 0.492. The average polymorphism information content (PIC) is 0.610. All these data indicate a good genetic diversity of screening loci in the outbred groups and large heterozygosity difference among the laboratory experimental chicken populations.


LociObserved number of allelesEffective number of allelesShannon’s information indexEffective heterozygosityPIC

MCW002942.9311.2090.5790.603
GGNCAMZO21.0690.1460.0600.062
ADL029353.2001.3110.5730.634
ADL031775.2361.7680.5540.783
GGAVIR31.9160.7960.4560.408
ADL020152.1031.0130.4290.482
GCT001653.0421.2740.3370.618
ADL030464.6411.6270.6660.751
MCW040286.0421.8810.7020.813
MCW006374.3191.6260.5680.736
ADL18553.2041.3590.6140.647
GGMYC21.8000.6370.4270.346
LEI009463.6741.4680.5620.683
LEI007443.7071.3480.5970.681
ADL32832.7851.0580.5260.565
GGVITC11.0000.0000.0001.000
GGANTECL32.8971.0800.6000.580
LEI09464.4441.5790.6900.738
MCW033043.2321.2690.5770.637
LEI014143.1621.2290.3410.623
ADL029232.7931.0610.4750.568
GGVITIIG21.9650.6840.4600.371
MCW008785.9301.8980.5440.810
MCW034731.9480.8150.4470.419
ADL17694.8461.8580.5220.773
ADL16653.7291.3800.5740.682
MCW001454.3421.5430.5920.735
GGCYMA31.6030.6320.3170.322
Mean4.5713.2701.1980.4920.610

In the other 3 haplotype populations, 14 microsatellite loci showed monomorphism in each population but showed different lengths in different haplotype populations. The average number of observed alleles is 1.571. The average number of effective alleles, the average Shannon’s information index, and the average effective heterozygosity are 1.433, 0.316, and 0.207, respectively (Table 6). The specific data of each haplotype population is shown in Supplementary Tables 1–3.


LociObserved number of allelesEffective number of allelesShannon’s information indexEffective heterozygosity

GGNCAMZO11.0000.0000.000
GGAVIR21.9230.6730.480
MCW040211.0000.0000.000
MCW006311.0000.0000.000
ADL18532.1740.8980.540
GGMYC11.0000.0000.000
LEI009432.7781.0550.640
GGVITC11.0000.0000.000
ADL029221.4710.5000.320
GGVITIIG22.0000.6930.500
ADL16611.0000.0000.000
MCW001411.0000.0000.000
GGCYMA11.0000.0000.000
STMSGGHU2-1A21.7240.6110.420
Mean1.5711.4340.3160.207

In the outbred group of duck, 25 microsatellite loci show polymorphism. The average number of observed alleles is 7.520, and the average number of effective alleles in the population is 4.162. The average Shannon’s information index is 1.574, and the average effective heterozygosity is 0.683. The average PIC is 0.698. These data showed that in the outbred groups, the genetic diversity of microsatellite DNA loci is better, and the genetic diversity of each locus is quite different. The specific results are shown in Table 7.


LociObserved number of allelesEffective number of allelesShannon’s information indexEffective heterozygosityPIC

CMO21184.6281.6980.7640.752
CAUD01195.0241.8350.7990.775
CAUD02793.6981.5880.6540.696
APH0984.8401.7280.7560.763
AY314127.2852.1650.8060.848
AY25893.5031.5860.7000.684
CAUD01842.9411.1940.6400.596
CAUD03184.4591.7110.7300.746
CAUD02674.6741.6970.7500.757
CAUD02372.7251.3150.5840.591
CMO21284.1541.6420.7390.724
CAUD00643.3331.2800.4400.645
CAUD00475.5561.8340.7200.798
CAUD00165.0001.6960.6000.772
CAUD034103.9431.7420.7300.723
CAUD00783.8941.6390.7140.713
APL57973.0681.4120.6350.636
CAUD01064.6551.6300.7680.753
CAUD02853.5491.3780.5410.668
CAUD01273.1221.3540.6520.630
CAUD035105.7681.9220.7590.804
CAUD01493.6001.4480.6960.672
CAUD032146.1592.1200.7970.821
APH1121.9230.6730.4790.365
APL242.5561.0670.6090.529
Mean7.5204.1621.5740.6830.698

In 4 haplotype populations, 15 microsatellite loci show monomorphism in each population. The average number of observed alleles is 4.133, the average number of effective alleles is 2.863, and the average Shannon’s information index is 1.153, indicating that the genetic diversity of the loci in these haplotype populations is poor; the average effective heterozygosity is 0.500, indicating that the heterozygosity difference is small and the genetic information of the selected loci is relatively single. See Table 8 for more detailed information, and the specific data in each haplotype population is shown in Supplementary Tables 4–7.


LociObserved number of allelesEffective number of allelesShannon’s information indexEffective heterozygosity

CAUD00232.0200.8570.360
CAUD00642.7401.1420.540
CAUD01831.8020.7460.400
CAUD00553.9451.4900.551
APL57952.6321.2050.500
APH1874.3011.6550.640
CAUD01032.5971.0100.420
CAUD02821.9800.6880.360
CAUD01232.5971.0100.420
CAUD03543.7561.3530.605
CAUD01443.5091.3060.580
CAUD02642.7401.1420.520
CMO21253.7741.4580.640
AY25842.3531.0630.500
CAUD03462.1981.1640.460
Mean4.1332.8631.1530.500

In the outbred colony of experimental goose, 14 loci were selected. The average number of observed alleles, the average number of effective alleles, the average Shannon’s information index, the average effective heterozygosity, and the PIC are 4.714, 3.038, 1.195, 0.528, and 0.582, respectively. The microsatellite loci have large interindividual differences within the population, and the population has high gene stability (Table 9).


LociObserved number of allelesEffective number of allelesShannon’s information indexEffective heterozygosityPIC

G-Ans1741.8430.7750.4410.388
G-TTUCG132.2550.9430.3810.494
G-APH1341.6050.7520.3150.352
G-Ans0285.3891.8370.7490.790
G-Ans0743.0731.2200.6340.613
G-Ans1832.2080.9220.3090.481
G-Ans2543.3331.2820.6290.647
G-Hhiμ1b42.9651.1470.4710.594
G-CKW4743.1431.2380.5730.623
G-Bcaμ532.7281.0510.4690.562
G-Bcaμ762.7311.1580.4550.562
G-Bcaμ872.8451.2900.6350.599
G-CAUD00643.7041.3440.6020.680
G-APH2084.7131.7720.7340.761
Mean4.7143.0381.1950.5280.582

The selected microsatellite loci all show good polymorphism in the experimental outbred pigeon populations. A total of 16 loci were selected. The average number of observed alleles is 7.875. The average effective allele number is 4.554; the average Shannon’s information index and the average effective heterozygosity are 1.559 and 0.649. The average PIC is 0.674 (Table 10).


LociObserved number of allelesEffective number of allelesShannon’s information indexEffective heterozygosityPIC

UU-Cli0253.6131.3740.6940.672
UU-Cli0642.9211.1630.3830.593
PG521.6810.5950.3970.323
C26L9(1265223)42.5761.0760.6020.533
UU-Cli14105.1441.9230.7870.784
C12L1(532572)42.8101.1180.4870.575
C12L4(906353)116.3752.0520.7660.825
CliμD1174.5411.6820.7340.750
C26L10(1404758)119.1182.2810.8600.880
C26L4(568923)135.8542.0620.8070.812
PG4106.8472.0170.7670.836
UU-Cli1282.8251.3640.6230.599
CliμT4773.4921.4130.6580.666
CliμD3296.6951.9910.8070.833
UU-Cli0751.3520.5920.2520.251
C26L1(20390)167.0142.2440.7590.844
Mean7.8754.5541.5590.6490.674

3.1.4. Population Genetic Structure Analysis

Among the three outbred chicken groups, the mean number of observed alleles, the mean number of effective alleles, the mean Shannon’s information index, and the mean effective heterozygosity are shown in Table 11. All these data are the highest in the Beijing oil chicken, indicating the best gene diversity.


ColoniesMean observed number of allelesMean effective number of allelesMean Shannon’s information indexMean effective heterozygosity

BWEL2.8572.0240.7300.424
BM2.8572.1320.8020.485
Beijing oil chicken4.4642.8211.0880.569

In the haplotype chicken populations, the highest mean observed number of alleles is observed in G7groups. Haplotype G7 has the highest mean effective allele number and the highest mean Shannon’s information index. The mean effective heterozygosity of haplotype G7 is 0.364. The genetic heterozygosity of the 3 populations is very low, and the consistency is good (Table 12).


ColoniesMean observed number of allelesMean effective number of allelesMean Shannon’s information indexMean effective heterozygosity

G11.5711.4340.3160.207
G21.6431.4090.3350.224
G72.0001.6260.5480.364

In the two outbred groups of duck, the mean number of observed alleles, the mean effective number of alleles, the mean Shannon’s index, and the mean effective heterozygosity of outbred group 1 are higher than those of outbred group JD, indicating that outbred group 1 had better diversity. The results are shown in Table 13. Among the 4 haplotype populations, the highest mean number of alleles is observed in haplotype A. Haplotype A has the highest mean Shannon’s information index. The highest mean effective heterozygosity in the duck groups is 0.489 in haplotype A (Table 14). The genetic heterozygosity of 4 populations is in good agreement.


ColoniesMean observed number of allelesMean effective number of allelesMean Shannon’s information indexMean effective heterozygosity

16.3203.5181.4100.685
JD5.2803.4661.3350.680


ColoniesMean observed number of allelesMean effective number of allelesMean Shannon’s information indexMean effective heterozygosity

A2.4002.0220.7600.489
B2.3332.0290.7450.484
C2.4001.9120.7260.459
D2.3331.9440.7010.442

In the two outbred groups of goose, the mean number of observed alleles, the mean effective number of alleles, and the mean Shannon’s index of Guangdong Wuzong goose are higher than those of Yangzhou goose, indicating that Guangdong Wuzong goose has a better diversity (Table 15).


ColoniesMean observed number of allelesMean effective number of allelesMean Shannon’s information indexMean effective heterozygosity

Guangdong Wuzong4.0002.7691.1120.618
Yangzhou3.7142.1550.8020.439

The analysis of the two main experimental pigeon populations used for scientific research shows that the mean effective heterozygosity of two populations is 0.647 and 0.651, respectively. The mean number of observed alleles, the mean effective number of alleles, and the mean Shannon’s index are higher in white king pigeons than in silver king pigeons. The comparison of the data is shown in Table 16.


ColoniesMean observed number of allelesMean effective number of allelesMean Shannon’s information indexMean effective heterozygosity

Silver king6.1253.2601.3070.647
White king7.3754.2471.4350.651

4. Discussion

Poultries are widely used and are indispensable supporting conditions for the life sciences and biomedicine industries. Specific pathogen-free (SPF) chicken embryos are used in the manufacture and quality control of biological product [4]; ducks play an important role in the research of avian influenza, fatty liver, duck hepatitis A, and duck hepatitis B [57]; goose blood contains a higher concentration of immunoglobulin, which is often used in pharmacology and toxicology research [8]; pigeons belong to the class of birds and are considered as important animal model in avian influenza research [9]. With the increasing demand for experiment poultry, people are paying more attention to the genetic structure analysis and genetic quality control. However, the current methods of genetic structure analysis and genetic quality control for experimental poultry animals are insufficient.

Coat colour gene testing method, biochemical marker gene testing method, immune marker gene testing method, and DNA molecular marker method are popular methods for genetic monitoring. Microsatellite DNA, mitochondrial DNA (mtDNA), restriction fragment length polymorphism (PCR-RFLP), single-stranded conformation polymorphism (PCR-SSCP), and specific gene polymorphisms are commonly used DNA molecular marker methods [2427]. Among them, microsatellite DNA has become valuable tools for evaluating population genetic diversity due to their unique virtue.

Microsatellite DNA is characterized by short tandem repeats (STRs) of 1 to 6 nucleotides in eukaryotic genome with a random manner [28]. It has rich polymorphism and large genetic information. Microsatellite can be used to distinguish heterozygous from homozygous because of their codominant inheritance feature [29]. In previous studies, microsatellites have been used as biomarkers for monitoring rodent genetic traits [30, 31]. With the deep understanding of microsatellites, it plays a more important role in genetic monitoring for being simple, clear, and stable in operation. In this research, we screened out microsatellite loci with suitable length and high specificity as candidate loci by gel electrophoresis firstly. Then, we performed STR scanning on these candidate loci. Microsatellite loci with good polymorphism, abundant alleles in the outbred groups, and good monomorphism in the haplotype populations were selected to form the microsatellite marker system. We analyzed the average effective allele number, average Shannon’s index, average effective heterozygosity, and other analytical indices to estimate genetic variation in different groups.

The mean effective number of alleles is an indicator of genetic variation and mutation drift balance. In our study, Beijing oil chicken has the highest mean effective allele number of three outbred chicken populations; outbred duck group 1 has higher mean effective allele number than outbred duck group JD. The outbred goose group Guangdong Wuzong and outbred pigeon group white king have the highest mean number of effective alleles in outbred goose populations and outbred pigeon populations, respectively. The higher mean effective number of alleles indicates that the population can maintain the original gene and avoid new variations under the pressures from genetic drift and artificial selection. The results show that Beijing oil chicken, outbred duck group 1, Guangdong Wuzong goose, and white king pigeon are the most stable strains in the outbred group of experiment chicken, duck, goose, and pigeon groups in this research, respectively.

The mean effective heterozygosity of a population is an important indicator of population genetic diversity and can reflect the richness of the detected genes. It is generally believed that when the mean effective heterozygosity of the population is less than 0.5, it indicates that the individual differences in the population are small and the genetic heterozygosity is low, which does not conform to the genetic characteristics of an outbred group animal. When the mean effective heterozygosity of the population is higher than 0.7, its genetic diversity is high [32].

Hence, we found that the mean effective heterozygosity of BWEL, BM, and Beijing oil chicken groups is all greater than 0.5, which conforms to the characteristics of the outbred group. The mean effective heterozygosity of BWEL and BM chicken groups is nearly 0.5. The average effective heterozygosity of G1, G2, and G7 groups is all less than 0.5. It is also consistent with the background that BWEL, BM, and Beijing oil chickens are outbred colonies; Beijing oil chicken has abundant genetic diversity and high selection potential for it has the highest mean effective heterozygosity among the outbred chicken groups in this study. This may be due to the large population. Duck group 1 and JD duck all have a mean effective heterozygosity greater than 0.680 which indicates a high genetic diversity. The mean effective heterozygosity of Guangdong Wuzong goose group, silver king pigeon group, and white king pigeon group is all greater than 0.5 which reflects abundant genetic diversity. The mean effective heterozygosity of three haplotype chicken groups and four haplotype duck groups is 0.207 and 0.500, respectively. The result indicates a good consistency in haplotype chickens and ducks. This may be the result of long-term full-sib and half-sib reproduction. Chickens and ducks are more widely used in biological research, and the breeding standards are stricter, while geese and pigeons are more useful in agriculture. Haplotype chickens have lower mean effective heterozygosity than haplotype duck populations, which is consistent with a longer history of breeding in experimental chickens.

When measuring the degree of gene variation, PIC is often used as a variation index. It is generally believed that when PIC is between 0.25 and 0.5, it is moderately polymorphic, and <0.25 shows a low level of polymorphism, when PIC is greater than 0.5, it means a high level of polymorphism [33]. In our microsatellite marker system, most of the microsatellite sites have a PIC greater than 0.5 that show high polymorphism. All these data prove that our microsatellite marker system provides rich genetic information, which can be used as effective genetic markers. In our study, highly polymorphic microsatellite marker systems showed powerful markers for quantifying genetic variations within and between poultry populations. We will collect more samples to make a more accurate description of genetic structure of the Chinese experimental chickens, ducks, geese, and pigeons in the future [34].

5. Conclusions

In conclusion, we identified appropriate microsatellite marker systems for native experimental chickens, ducks, geese, and pigeons in China. The combination of loci selected in our research provides a good choice for genetic monitoring of the quality and the population genetic diversity of poultry stocks.

Data Availability

All data, models, and code generated or used during the study appear in the submitted article.

Conflicts of Interest

The authors declare that there is no conflict of interest regarding the publication of this paper.

Acknowledgments

We are very grateful to the Institute of Animal Science, Chinese Academy of Agricultural Sciences, Harbin Veterinary Research Institute, Southern Medical University and Yangzhou University for providing animal samples for this study. This work was supported by the Beijing Municipal Science and Technology Projects (No. D181100000518002), Support Project of High-level Teachers in Beijing Municipal Universities in the Period of 13th Five-year Plan (Grant Number IDHT20170516), and the National Key Research and Development Plan of China (No. 2017YFD0501602).

Supplementary Materials

Supplementary Table 1: number of alleles, effective alleles, effective heterozygosity, and Shannon’s index of the G1 haplotype chicken population. Supplementary Table 2: number of alleles, effective alleles, effective heterozygosity, and Shannon’s index of the G2 haplotype chicken population. Supplementary Table 3: number of alleles, effective alleles, effective heterozygosity, and Shannon’s index of the G7 haplotype chicken population. Supplementary Table 4: number of alleles, effective alleles, effective heterozygosity, and Shannon’s index of the A haplotype duck population. Supplementary Table 5: number of alleles, effective alleles, effective heterozygosity, and Shannon’s index of the B haplotype duck population. Supplementary Table 6: number of alleles, effective alleles, effective heterozygosity, and Shannon’s index of the C haplotype duck population. Supplementary Table 7: number of alleles, effective alleles, effective heterozygosity, and Shannon’s index of the D haplotype duck population. (Supplementary Materials)

References

  1. E. P. Neff, “What is a lab animal?” Lab Anim (NY), vol. 47, no. 9, pp. 223–227, 2018. View at: Publisher Site | Google Scholar
  2. M. B. Bello, K. Yusoff, A. Ideris, M. Hair-Bejo, B. P. H. Peeters, and A. R. Omar, “Diagnostic and vaccination approaches for Newcastle disease virus in poultry: the current and emerging perspectives,” BioMed Research International, vol. 2018, 18 pages, 2018. View at: Publisher Site | Google Scholar
  3. M. L. Dequéant and O. Pourquié, “Chicken genome: new tools and concepts,” Developmental dynamics : an official publication of the American Association of Anatomists, vol. 232, no. 4, pp. 883–886, 2005. View at: Publisher Site | Google Scholar
  4. H. B. Yin, C. H. Chen, M. J. Darre, A. M. Donoghue, D. J. Donoghue, and K. Venkitanarayanan, “Phytochemicals reduce aflatoxin-induced toxicity in chicken embryos,” Poultry Science, vol. 96, no. 10, pp. 3725–3732, 2017. View at: Publisher Site | Google Scholar
  5. A. M. Ramey, A. B. Reeves, J. Z. Drexler et al., “Influenza A viruses remain infectious for more than seven months in northern wetlands of North America,” Proceedings of the Royal Society B: Biological Sciences, vol. 287, no. 1934, p. 20201680, 2020. View at: Publisher Site | Google Scholar
  6. Y. Fu, M. Pan, X. Wang, Y. Xu, H. Yang, and D. Zhang, “Molecular detection and typing of duck hepatitis A virus directly from clinical specimens,” Veterinary Microbiology, vol. 131, no. 3-4, pp. 247–257, 2008. View at: Publisher Site | Google Scholar
  7. Q. Pan, L. Liu, Y. Wang et al., “The first whole genome sequence and pathogenicity characterization of a fowl adenovirus 4 isolated from ducks associated with inclusion body hepatitis and hydropericardium syndrome,” Avian Pathology, vol. 46, no. 5, pp. 571–578, 2017. View at: Publisher Site | Google Scholar
  8. T. Huang, K. Wu, X. Yuan et al., “Molecular analysis of the immunoglobulin genes in goose,” Developmental and Comparative Immunology, vol. 60, pp. 160–166, 2016. View at: Publisher Site | Google Scholar
  9. J. H. Kwon, Y. K. Noh, D. H. Lee et al., “Experimental infection with highly pathogenic H5N8 avian influenza viruses in the mandarin duck (Aix galericulata) and domestic pigeon (Columba livia domestica),” Veterinary Microbiology, vol. 203, pp. 95–102, 2017. View at: Publisher Site | Google Scholar
  10. M. Nunome, K. Kinoshita, S. Ishishita, Y. Ohmori, A. Murai, and Y. Matsuda, “Genetic diversity of 21 experimental chicken lines with diverse origins and genetic backgrounds,” Experimental Animals, vol. 68, no. 2, pp. 177–193, 2019. View at: Publisher Site | Google Scholar
  11. M. G. Strillacci, M. C. Cozzi, E. Gorla et al., “Genomic and genetic variability of six chicken populations using single nucleotide polymorphism and copy number variants as markers,” Animal : an international journal of animal bioscience, vol. 11, no. 5, pp. 737–745, 2017. View at: Publisher Site | Google Scholar
  12. H. Khatib, E. Genislav, L. B. Crittenden, N. Bumstead, and M. Soller, “Sequence-tagged microsatellite sites as markers in chicken reference and resource populations,” Animal Genetics, vol. 24, no. 5, pp. 355–362, 1993. View at: Publisher Site | Google Scholar
  13. C. Gao, L. Han, J. Han et al., “Establishment of six homozygous MHC- _B_ haplotype populations associated with susceptibility to Marek 's disease in Chinese specific pathogen-free BWEL chickens,” Infection, Genetics and Evolution, vol. 29, pp. 15–25, 2015. View at: Publisher Site | Google Scholar
  14. D. Seo, M. S. Bhuiyan, H. Sultana, J. M. Heo, and J. H. Lee, “Genetic diversity analysis of south and east Asian duck populations using highly polymorphic microsatellite markers,” Asian-Australasian Journal of Animal Sciences, vol. 29, no. 4, pp. 471–478, 2016. View at: Publisher Site | Google Scholar
  15. S. A. Stringham, E. E. Mulroy, J. Xing et al., “Divergence, convergence, and the ancestry of feral populations in the domestic rock pigeon,” Current biology : CB, vol. 22, no. 4, pp. 302–308, 2012. View at: Publisher Site | Google Scholar
  16. J. H. Seo, J. H. Lee, and H. S. Kong, “Assessment of genetic diversity and phylogenetic relationships of Korean native chicken breeds using microsatellite markers,” Asian-Australasian Journal of Animal Sciences, vol. 30, no. 10, pp. 1365–1371, 2017. View at: Publisher Site | Google Scholar
  17. B. H. Rudresh, H. N. N. Murthy, M. R. Jayashankar, C. S. Nagaraj, A. M. Kotresh, and S. M. Byregowda, “Microsatellite based genetic diversity study in indigenous chicken ecotypes of Karnataka,” Veterinary world, vol. 8, no. 8, pp. 970–976, 2015. View at: Publisher Site | Google Scholar
  18. Y. Huang, J. Tu, X. Cheng et al., “Characterization of 35 novel microsatellite DNA markers from the duck (Anas platyrhynchos) genome and cross-amplification in other birds,” Genetics, selection, evolution : GSE, vol. 37, no. 5, pp. 455–472, 2005. View at: Publisher Site | Google Scholar
  19. Y. Su, R. Long, G. Chen, X. Wu, K. Xie, and J. Wan, “Genetic analysis of six endangered local duck populations in China based on microsatellite markers,” Journal of Genetics and Genomics, vol. 34, pp. 1010–1018, 2007. View at: Publisher Site | Google Scholar
  20. J. C.-I. Lee, L.-C. Tsai, Y.-Y. Kuan et al., “Racing pigeon identification using STR and chromo-helicase DNA binding gene markers,” Electrophoresis, vol. 28, no. 23, pp. 4274–4281, 2007. View at: Publisher Site | Google Scholar
  21. K. Andres and E. Kapkowska, “Applicability of anatid and galliform microsatellite markers to the genetic diversity studies of domestic geese (Anser anser domesticus) through the genotyping of the endangered zatorska breed,” BMC Research Notes, vol. 4, no. 1, pp. 1–10, 2011. View at: Publisher Site | Google Scholar
  22. R. Parada, J. Ksiazkiewicz, M. Kawka, and K. Jaszczak, “Studies on resources of genetic diversity in conservative flocks of geese using microsatellite DNA polymorphic markers,” Molecular Biology Reports, vol. 39, no. 5, pp. 5291–5297, 2012. View at: Publisher Site | Google Scholar
  23. N. R. Lebas and P. B. Spencer, “Polymorphic microsatellite markers in the ornate dragon lizard, Ctenophorus ornatus,” Molecular ecology, vol. 9, no. 3, pp. 365-366, 2000. View at: Publisher Site | Google Scholar
  24. I. Barbaric, M. Stewart, S. Wells, and T. N. Dear, “A new coat color mouse line for testing germline transmission of embryonic stem cells while retaining an inbred genetic background,” Journal of the American Association for Laboratory Animal Science, vol. 46, no. 3, pp. 37–40, 2007. View at: Google Scholar
  25. M. N. Weitzmann, K. J. Woodford, and K. Usdin, “The mouse Ms6-hm hypervariable microsatellite forms a hairpin and two unusual tetraplexes,” The Journal of Biological Chemistry, vol. 273, no. 46, pp. 30742–30749, 1998. View at: Publisher Site | Google Scholar
  26. G. Bulfield and G. Bantin, “Genetic monitoring of inbred strains of mice using electrophoresis and electrofocusing,” Laboratory Animals, vol. 15, no. 2, pp. 147–149, 1981. View at: Publisher Site | Google Scholar
  27. J. R. Fahey, H. Katoh, R. Malcolm, and A. V. Perez, “The case for genetic monitoring of mice and rats used in biomedical research,” Mammalian genome : official journal of the International Mammalian Genome Society, vol. 24, no. 3-4, pp. 89–94, 2013. View at: Publisher Site | Google Scholar
  28. Y. C. Li, A. B. Korol, T. Fahima, A. Beiles, and E. Nevo, “Microsatellites: genomic distribution, putative functions and mutational mechanisms: a review,” Molecular Ecology, vol. 11, no. 12, pp. 2453–2465, 2002. View at: Publisher Site | Google Scholar
  29. A. Grover and P. C. Sharma, “Development and use of molecular markers: past and present,” Critical Reviews in Biotechnology, vol. 36, no. 2, pp. 290–302, 2014. View at: Publisher Site | Google Scholar
  30. X. Liu, X. Yu, Y. Xu et al., “Development of an effective microsatellite marker system to determine the genetic structure of Meriones meridianus populations,” Experimental Animals, vol. 69, no. 2, pp. 224–232, 2020. View at: Publisher Site | Google Scholar
  31. X. Y. Du, W. Li, X. Y. Sa et al., “Selection of an effective microsatellite marker system for genetic control and analysis of gerbil populations in China,” Genetics and Molecular Research, vol. 14, no. 3, pp. 11030–11042, 2015. View at: Publisher Site | Google Scholar
  32. R. Chakraborty, Y. Zhong, M. de Andrade, P. R. Clemens, R. G. Fenwick, and C. T. Caskey, “Linkage disequilibria among (CA)n polymorphisms in the human dystrophin gene and their implications in carrier detection and prenatal diagnosis in Duchenne and Becker muscular dystrophies,” Genomics, vol. 21, no. 3, pp. 567–570, 1994. View at: Publisher Site | Google Scholar
  33. T. Vanhala, M. Tuiskula-Haavisto, K. Elo, J. Vilkki, and A. Mäki-Tanila, “Evaluation of genetic variability and genetic distances between eight chicken lines using microsatellite markers,” Poultry Science, vol. 77, no. 6, pp. 783–790, 1998. View at: Publisher Site | Google Scholar
  34. J. K. Pritchard, M. Stephens, and P. Donnelly, “Inference of population structure using multilocus genotype data,” Genetics, vol. 155, no. 2, pp. 945–959, 2000. View at: Google Scholar

Copyright © 2021 Xiulin Zhang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views275
Downloads279
Citations

Related articles

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.