Oxidative Medicine and Cellular Longevity

Oxidative Medicine and Cellular Longevity / 2020 / Article
Special Issue

The Potential Role of Exosomes and Oxidative Stress in Diabetes and Vascular Aging

View this Special Issue

Research Article | Open Access

Volume 2020 |Article ID 1904609 | https://doi.org/10.1155/2020/1904609

Tingting Zhao, Junling Gu, Huixia Zhang, Zhe Wang, Wenqian Zhang, Yonghua Zhao, Ying Zheng, Wei Zhang, Hua Zhou, Guilin Zhang, Qingmin Sun, Enchao Zhou, Zhilong Liu, Youhua Xu, "Sodium Butyrate-Modulated Mitochondrial Function in High-Insulin Induced HepG2 Cell Dysfunction", Oxidative Medicine and Cellular Longevity, vol. 2020, Article ID 1904609, 16 pages, 2020. https://doi.org/10.1155/2020/1904609

Sodium Butyrate-Modulated Mitochondrial Function in High-Insulin Induced HepG2 Cell Dysfunction

Guest Editor: Yue Liu
Received27 Apr 2020
Accepted01 Jun 2020
Published17 Jul 2020

Abstract

The liver plays a pivotal role in maintaining euglycemia. Biogenesis and function of mitochondria within hepatocytes are often the first to be damaged in a diabetic population, and restoring its function is recently believed to be a promising strategy on inhibiting the progression of diabetes. Previously, we demonstrated that the gut microbiota metabolite butyrate could reduce hyperglycemia and modulate the metabolism of glycogen in both db/db mice and HepG2 cells. To further explore the mechanism of butyrate in controlling energy metabolism, we investigated its influence and underlying mechanism on the biogenesis and function of mitochondria within high insulin-induced hepatocytes in this study. We found that butyrate significantly modulated the expression of 54 genes participating in mitochondrial energy metabolism by a PCR array kit, both the content of mitochondrial DNA and production of ATP were enhanced, expressions of histone deacetylases 3 and 4 were inhibited, beta-oxidation of fatty acids was increased, and oxidative stress damage was ameliorated at the same time. A mechanism study showed that expression of GPR43 and its downstream protein beta-arrestin2 was increased on butyrate administration and that activation of Akt was inhibited, while the AMPK-PGC-1alpha signaling pathway and expression of p-GSK3 were enhanced. In conclusion, we found in the present study that butyrate could significantly promote biogenesis and function of mitochondria under high insulin circumstances, and the GPR43-β-arrestin2-AMPK-PGC1-alpha signaling pathway contributed to these effects. Our present findings will bring new insight on the pivotal role of metabolites from microbiota on maintaining euglycemia in diabetic population.

1. Introduction

Type 2 diabetes (T2D) has become a major threat to health worldwide. It is estimated that the diabetic population will rise to 600 million people within the next 20 years, accounting for about 10% of the world population. The liver plays a pivotal role in maintaining euglycemia; unfortunately, as high as 19% of cases with type 2 diabetes are reported being accompanied with liver dysfunction [1].

The liver is one of the main target organs for insulin. By modulating glycogenesis or glucose oxidation within hepatocytes, blood glucose is maintained in a relatively stable state. However, a very high level of insulin, or the so-called insulin resistance (IR), will significantly destroy the capacity of the liver in this aspect, and the function and biogenesis of mitochondria are often the first to be damaged [2, 3]. In this sense, restoring the function of mitochondria is pivotal to inhibit the progression of T2D.

With the understanding of the important role of gut microbiota in disease development, interests have focused on exploring the mechanism of a potential target for controlling T2D. In 2012, Qin and colleagues firstly demonstrated that butyrate-producing bacteria were significantly reduced in a T2D population [4]. Thereafter, studies suggested the potential role of butyrate supplementation on modulating diabetes [5, 6]. Previously, we demonstrated in db/db mice that oral administration with sodium butyrate (NaB) significantly reduced HbA1c and diabetic inflammation [7]; more importantly, hypertrophy and steatosis of hepatocytes in db/db mice were significantly reversed by NaB, accompanied with enhancement of glycogen metabolism [8]. To further investigate the potential role of NaB on mitochondria, we carried out a series of experiments to observe both the biogenesis and function of mitochondria under high insulin circumstances in this study; the underlying mechanism was also explored. Our present study may bring new insight on understanding the pivotal role of metabolites from microbiota in controlling energy metabolism.

2. Materials and Methods

2.1. Materials

Sodium butyrate (NaB) was provided by Meilun Biological Technology (Dalian, China). Antibodies or agents for GAPDH (sc-47724), GPR43 (sc-32906), β-arrestin2 (sc-13140), Akt (sc-514032), p-Akt (sc-8312), GSK3α/β (sc-7291), p-GSK3α/β (sc-81496), GPR43-siRNA (sc-77339), control siRNA-A (sc-37007), DCFH (sc-359840), and JC-1 iodide(sc-364116) were purchased from Santa Cruz (Dallas, TX); AMPK (5832s) and p-AMPK (2531s) were purchased from Cell Signaling Technology (Danvers, MA); PGC1-alpha (ab54481) was purchased from Abcam (Cambridge, UK); and insulin receptor (bs-0681R) was purchased from BIOSS (Greater Boston, New England). The QIAamp® DNA Micro Kit (56304) and RT2 Profiler™ PCR Array Human Mitochondrial Energy Metabolism (330231) were from QIAGEN (Hilden, Germany); LongAmp® Taq 2X Master Mix (M0287S) was from New England Biolabs (Hitchin, Hertfordshire); and DNA Gel Loading Dye (6X) (R0611), SYBR™ Safe DNA Gel Stain (S33102), and MitoTracker™ Deep Red FM (M22426) were from Thermo Scientific (Massachusetts, US). 1-Step Quantitative Reverse Transcription PCR (RT-qPCR) from RNA (1725151) was from BIO-RAD (California, US). ReverTra Ace® qPCR RT Master Mix (FSQ-201) was from Toyobo (Osaka, Japan). Detection kits for ATP, GPX, SOD, and MDA were supplied by Beyotime (Shanghai, China). Kits for NOX2 (SED308Hu) and ACACa (SEB284Hu) were derived from Youersheng (Wuhan, Hubei, China). All other reagents were from commercial sources.

2.2. Cell

HepG2 cells (hepatocyte cell line) were purchased from the American Type Culture Collection (ATCC, Manassas, VA). The cells were cultured in high-glucose MEM medium (Gibco) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin at 37°C in a 95% air/5% CO2 cell incubator.

2.3. Integration of Protein-Protein Interaction Network Analysis

The STRING database (https://string-db.org/) is applied to predict possible interactions among proteins according to the function and pathway enrichment analysis.

2.4. DNA Fragmentation Observation

HepG2 cells were seeded in 6-well plates and treated with insulin or NaB. Total DNA was purified using the DNA extraction kit, separated by 1% agarose gel, and finally visualized using a GelDoc™ XR+ imaging system (Bio-Rad, Philadelphia, PA, USA).

2.5. Quantitative Real-Time PCR (Q-PCR)

Total RNA from HepG2 cells treated with insulin or NaB for 24 h were extracted using a TRIzol reagent according to the manufacturer’s protocol. Concentration of RNA was determined by a NanoDrop 2000 instrument (Bio-Rad, USA). cDNA was reverse-transcripted from RNA by a cDNA synthesis kit according to the protocol from the supplier as follows: priming for 5 min at 25°C, reverse transcription for 20 min at 46°C, and RT inactivation for 1 min at 95°C. Real-time PCR was performed by FastStart Universal SYBR Green Master. Each sample was mixed with 10 μl SYBR master mix, 2 μl primers (mixture with both forward and reverse primers), 0.1 μl cDNA, and DEPC-treated water to make up a total reaction volume of 20 μl. Mixtures were circulated for 40 cycles using a high-productivity real-time quantitative PCR ViiATM7 (Life Technologies, Gaithersburg, MD, USA). The reference gene was β-actin. Each experiment was repeated for at least three times. Sequences for primers used in PCR analysis are listed in Table 1.


Forward primers (5 to 3)Reverse primers (5 to 3)

GLUT2GACAGTGAAAACCAGGGTCCTGTGCCACACTCACACAAGA
GLUT4GCCCTAACTTTCTTCCTCTCCCTCCGACCTTTGGTTTCTTCTCTCA
HDAC3CTGTGTAACGCGAGCAGAACGCAAGGCTTCACCAAGAGTC
HDAC4CTGGTCTCGGCCAGAAAGTCGTGGAAATTTTGAGCCATT
ACADSCCCATCTTCTTCACCTGAGCACACACCAGATGTTGCTCCA
HADHACCCTGAGCACCATAGCGACAGCGAATCGGTCTTGTCTGG
CPT1AATCAATCGGACTCTGGAAACGGTCAGGGAGTAGCGCATGGT
β-ActinGTTGTCGACGACGAGCGGCACAGAGCCTCGCCTT
nDNATGAGGCCAAATATCATTCTGAGGGGCTTTCATCATGCGGAGATGTTGGATGG
mtDNAACATGATTAGCAAAAGGGCCTAGCTTGGACTCAGATGCACCTGCTCTGTGATTATGACTATCCCACAGTC
MinArcCTAAATAGCCCACACGTTCCCAGAGCTCCCGTGAGTGGTTA
β2MGCTGGGTAGCTCTAAACAATGTATTCACCATGTACTAACAAATGTCTAAAATGGT

2.6. PCR Array Analysis

Quantitative PCR array analysis was carried out using an RT2 Profiler™ PCR Array Human Mitochondrial Energy Metabolism (QIAGEN). HepG2 cells were treated with high insulin or high insulin+NaB as indicated. Total RNA was extracted by TRIzol; cDNA was prepared from purified RNA using a ReverTra Ace® qPCR RT Master Mix (FSQ-201, Toyobo); the PCR array assay was analyzed by the kit using the high-productivity real-time quantitative PCR ViiATM7 (Life Technologies, Gaithersburg, MD, USA) according to the manufacturer’s instruction. After data collection, relative gene expression was presented as ; the fold change in the gene expression was calculated using the 2ΔΔCt method.

2.7. Flow Cytometry

HepG2 cells ( cells/well) were seeded in a 6-well plate and administrated with insulin (0.1 μM) or NaB (0.5 mM) for 24 h. Cells were harvested and suspended with PBS solution. Then, the cells were stained with deep red mitochondria (50 nM), DCFH (10 μM), JC-1 iodide (2.5 μg/ml), or 2-NBDG (100 μM) for 15 min at room temperature in the dark. The subpopulation of cells was estimated with a BD Aria III Flow Cytometer (BD Biosciences, San Jose, California, USA).

2.8. Knockdown of GPR43

Expressions of GPR43 in HepG2 cells were knocked down according to the protocol from the provider. In general, Lipofectamine® RNAiMAX (13778150) and GPR43 siRNA (sc-77339) were diluted in an Opti-MEM® Medium as instructed from the protocol and then were mixed at the ratio of 1 : 1. The siRNA-lipid mixture was incubated for 10 minutes at room temperature and then cocultured with the cells for 1-3 days within the cell incubator at 37°C.

2.9. Mitochondrial Imaging

HepG2 cells were incubated with the MitoTracker™ Deep Red staining solution (50 nM) in the dark for 20 minutes. After being washed with PBS, the mitochondria were observed under a laser confocal microscope (Leica TCS SP8, Germany).

2.10. Immunofluorescence Assay

Cells at the exponential state were incubated with insulin or NaB. Twenty-four hours later, cells were treated with 4% paraformaldehyde for 30 min. The cells were then blocked with 5% BSA and incubated with primary antibodies including GPR432 (1 : 200), insulin receptor (1 : 200), p-AKT (1 : 200), AKT (1 : 200), p-GSK3 (1 : 200), GSK3 (1 : 200), PGC1-α (1 : 200), AMPK (1 : 200), p-AMPK (1 : 200), or β-arrestin2 (1 : 200) at 4°C overnight. After being gently washed with PBS, cells were further incubated with FITC- or CY3-conjugated secondary antibody. The nucleus was stained with DAPI. Finally, the cells were observed under a confocal laser scanning microscope (Leica TCS SP8, Germany), and the fluorescent density was determined by ImageJ software.

2.11. Enzyme Immunoassay (EIA)

Levels of malondialdehyde (MDA), glutathione peroxidase (GPX), superoxide dismutase (SOD), NOX2, adenosine triphosphate (ATP), and ACACa were determined by kits according to the manufacturers’ protocols.

2.12. Statistical Analysis

All data were obtained from more than three independent repeated experiments and were analyzed by GraphPad Prism 5 software; data that fit into the normal distribution were expressed as (SD), and the differences among groups were analyzed by the one-way ANOVA method. Comparisons between two groups were made using Student’s -test. was considered as statistically significant.

3. Results

3.1. Sodium Butyrate (NaB) Modulated Genes Related with Mitochondrial Energy Metabolism

Previously, we have demonstrated that NaB promoted glycogen metabolism within hepatocytes [8] and decreased the glucose level in db/db mice [7]. As mitochondria play a pivotal role in modulating energy balance, we further carried out experiments to investigate influence of NaB on mitochondria under insulin resistance (IR) circumstances. To this end, we firstly determined changes of gene expression related with mitochondrial energy metabolism by a PCR array kit. As shown in Table 2 and Figures 1(a)1(c), 35 genes were downregulated and 19 genes were upregulated in NaB-incubated cells compared with the model group (high insulin); among these genes, UQCRC1 was upregulated by as high as 90-folds, while COX6C was downregulated by 0.63-fold.


GeneAccession no.Normalized ratio (insulin+NaB/insulin) valueUp/downregulation

ATP12ANM_001185085.11.20140.0531
ATP4ANM_000704.30.14170.0006Down
ATP4BNM_000705.40.06540.0004Down
ATP5A1NM_001001935.30.46480.1675Down
ATP5BNM_001686.40.21710.0001Down
ATP5C1NM_001001973.30.08270.0004Down
ATP5F1NM_001688.50.62470.0002
ATP5G1NM_005175.31.12090.4700
ATP5G2NM_001330269.10.1045<0.0001Down
ATP5G3NM_001190329.20.0006<0.0001Down
ATP5HNM_006356.30.31970.0593Down
ATP5INM_007100.40.0655<0.0001Down
ATP5JNM_001003703.13.19980.0354Up
ATP5J2NM_004889.59.88110.0006Up
ATP5LNM_006476.50.5051<0.0001
ATP5ONM_001697.30.62470.0002
ATP6V0A2NM_012463.40.64080.0006
ATP6V0D2NM_152565.10.62470.0002
ATP6V1C2NM_001039362.22.53390.0187Up
ATP6V1E2NM_001318063.20.50280.0212Down
ATP6V1G3NM_001320218.11.23510.5168
BCS1LNM_001079866.20.75510.8782
COX4I1NM_001861.60.65430.1425
COX4I2NM_032609.313.1592<0.0001Up
COX5ANM_004255.40.76210.0348
COX5BNM_001862.31.31460.3899
COX6A1NM_004373.40.0004<0.0001Down
COX6A2NM_005205.42.74730.0264Up
COX6B1NM_001863.50.0837<0.0001Down
COX6B2NM_001369798.10.0006<0.0001Down
COX6CNM_004374.40.63200.0003Down
COX7A2NM_001865.422.08000.0001Up
COX7A2LNM_004718.40.0008<0.0001Down
COX7BNM_001866.30.78170.0019
COX8ANM_004074.35.49450.0001Up
COX8CNM_182971.33.6587<0.0001Up
CYC1NM_001916.50.0004<0.0001Down
LHPPNM_022126.40.62470.0002
NDUFA1NM_004541.41.35790.0354
NDUFA10NM_001322019.10.62470.0002
NDUFA11NM_001193375.20.77450.0059
NDUFA2NM_002488.52.22120.0970
NDUFA3NM_004542.41.27570.0033
NDUFA4NM_002489.42.8706<0.0001
NDUFA5NM_001291304.10.62470.0002
NDUFA6NM_002490.62.80500.0002Up
NDUFA7NM_005001.50.67580.0504
NDUFA8NM_001318195.27.95210.0023Up
NDUFAB1NM_005003.319.85370.0002Up
NDUFB10NM_004548.373.58470.0001Up
NDUFB2NM_004546.30.00010.0001Down
NDUFB3NM_001257102.20.06570.0044Down
NDUFB4NM_001168331.20.00050.0001Down
NDUFB5NM_002492.40.0008<0.0001Down
NDUFB6NM_002493.50.86930.0576
NDUFB7NM_004146.60.0003<0.0001Down
NDUFB8NM_005004.40.53510.1035
NDUFB9NM_005005.30.00350.0001Down
NDUFC1NM_001184986.10.04730.0001Down
NDUFC2NM_004549.60.3450<0.0001Down
NDUFS1NM_005006.70.61760.0039
NDUFS2NM_004550.40.0031<0.0001Down
NDUFS3NM_004551.30.62470.0002
NDUFS4NM_002495.40.3749<0.0001Down
NDUFS5NM_004552.30.62470.0002
NDUFS6NM_004553.60.1052<0.0001Down
NDUFS7NM_024407.52.18560.0002Up
NDUFS8NM_002496.40.62470.0002
NDUFV1NM_007103.40.0424<0.0001Down
NDUFV2NM_021074.523.3389<0.0001Up
NDUFV3NM_021075.40.1932<0.0001Down
OXA1LNM_005015.50.03010.0001Down
PPA1NM_021129.40.55020.0019
PPA2NM_176869.30.0111<0.0001Down
SDHANM_004168.40.18320.0008Down
SDHBNM_003000.326.9336<0.0001Up
SDHCNM_003001.50.07850.0005Down
SDHDNM_003002.42.8905<0.0001Up
UQCR11NM_006830.45.67520.0049Up
UQCRC1NM_003365.390.3843<0.0001Up
UQCRC2NM_003366.40.13320.0119Down
UQCRFS1NM_006003.34.9178<0.0001Up
UQCRHNM_006004.41.8506<0.0001
UQCRQNM_014402.50.0390<0.0001Down

To predict possible mechanism and signaling pathways, protein-protein interaction among genes was generated from the STRING database. As depicted in Figure 1(d), AKT and AMPK signaling pathways play a pivotal role in modulating the top ten changed genes within the mitochondria, and receptors for short chain fatty acids (SCFAs) may influence the balance of AKT and AMPK pathways.

3.2. Mitochondrial Function Was Enhanced by NaB

To investigate role of NaB on mitochondria, we firstly determined its DNA. As shown in Figure 2(a), content of mitochondrial DNA (mtDNA) was significantly reduced by high insulin (IR), administration with NaB dramatically increased its level ( vs. IR), and the most significant effect was observed at 24 h. By immunofluorescence assay (Figure 2(b)), PCR determination (Figure 2(c)), and flow cytometry assay (Figures 2(d) and 2(e)), we confirmed that the content and copy number of mtDNA were significantly increased by NaB treatment. More importantly, mitochondrial membrane potential as probed by JC-1 was significantly elevated (Figures 2(f) and 2(g)), and ATP production was enhanced (Table 3). The above findings demonstrated that administration with NaB could significantly reverse high insulin-induced hepatocyte dysfunction by promoting the function of mitochondria.


GroupATP (nM/mg prot)

NC
IR
IR+NaB#

NC: normal control; IR: high insulin-induced insulin resistance; NaB: sodium butyrate. vs. NC; # vs. IR.
3.3. NaB Ameliorated Oxidative Stress Damage under High Insulin Circumstances

Mitochondria are the major source of reactive oxygen species (ROS), and accumulation of ROS will lead to decreased mitochondrial membrane potential and ATP production [9]. To evaluate oxidative stress after NaB administration, we determined the level of ROS by a flow cytometer (Figures 3(a) and 3(b)) and observed its content under a fluorescence microscope (Figure 3(c)); we found that insulin resistance (IR) is accompanied by overproduction of ROS, and NaB can significantly inhibit this elevation. NADPH oxidase 2 (NOX2) within mitochondria plays a pivotal role in the production of ROS. In the present study, NaB dramatically inhibited activity of NOX2 induced by IR (Figure 3(d)); other enzymes and products within hepatocytes including antioxidative SOD and GPX and prooxidative MDA were also ameliorated by NaB (Table 4).


GroupSOD (mU/mg prot)GPX (mU/mg prot)MDA (nM/mg prot)

NC
IR
IR+NaB######

NC: normal control; IR: high insulin-induced insulin resistance; NaB: sodium butyrate. vs. NC; ## vs. IR.
3.4. NaB Mediated β-Oxidation of Fatty Acids and Histone Acetylation in Hepatocytes

Acetyl-CoA carboxylase alpha (ACACa) is the rate-limiting enzyme in fatty acid synthesis and is believed to be a novel target for endocrine disease, e.g., diabetes and obesity. In our present study, the level of ACACa was dramatically reduced by high insulin and NaB incubation significantly increased its content to the normal level (Figure 4(a)). CPT1A, HADH, and ACADS are pivotal rate-limiting enzymes in fatty acid catabolism within mitochondria during the β-oxidation process [10]. We found that high insulin significantly inhibited their mRNA expression, while this was reversed by NaB administration (Figures 4(b)4(d)). In this sense, NaB application modulated the metabolism of fatty acids within hepatocytes and exhibited protective effects on the function of the mitochondrial electron transfer chain under high insulin circumstances.

Histone deacetylase (HDAC) modulates deacetylation modification of histones, thus inhibiting gene translocation and thereafter energy metabolism. Activities of rate-limiting enzymes discussed above are modulated by both the histone acetylation level and deacetylase activity. HDAC3 and HDAC4 are typical HDACs that belong to class I and II HDACs, respectively, and loss of HDAC in the liver will result in increased glycogen storage and reduced blood glucose level [11]. In the present study, we found that NaB significantly inhibited the expression of HDAC3 and 4 induced by high insulin (Figures 4(e) and 4(f)).

3.5. GPR43 Mediated Function of NaB on Mitochondria

Previously, we have demonstrated that GPR43 mediated the function of NaB on glycogen metabolism within the hepatocyte [8]. To explore the underlying mechanism of NaB on mitochondria, we firstly knocked down the expression of GPR43 by siRNA and observed its influence on the shape and distribution of mitochondria under a confocal microscope. As shown in Figure 5(a), high insulin (IR) induced an obvious fragmentation of mitochondria; NaB incubation significantly reversed the shape change of mitochondria via GPR43. This was further demonstrated by an immunofluorescence assay that NaB significantly increased the expression of GPR43 that was inhibited by IR (Figures 5(b) and 5(c)).

There is a previous report which indicated that β-arrestin2 mediated internalization of GPR43 [12], and its expression in diabetic mice was dramatically reduced. In the present study, we observed that NaB application significantly induced the expression of β-arrestin2 within hepatocytes (Figures 5(d) and 5(e)); more importantly, expression of the insulin receptor was also upregulated by NaB (Figures 5(f) and 5(g)). This was consistent with protein-protein interaction prediction from the STRING database (Figure 1(d)).

In the current study, we also observed mRNA upregulation of GLUT2 (Figure 5(h)) but not GLUT4 (Figure 5(i)) by NaB incubation under high insulin circumstances. This is in line with our previous findings [8], suggesting the NaB-promoted entrance of glucose into the cells may benefit energy metabolism within mitochondria.

3.6. AMPK-PGC1-alpha Signaling Pathways Modulated Effects of NaB on Mitochondria

The AKT signaling pathway plays a pivotal role in modulating glucose uptake and metabolism within mitochondria. We found that high insulin significantly induced activation of AKT while reducing p-GSK3 compared with the normal control (), and NaB reversed this trend to the normal levels (Figures 6(a)6(d)). On the other hand, the AMPK-PGC1-alpha signaling pathway, which modulates both biogenesis and function of mitochondria, was significantly enhanced on application of NaB (Figures 6(e)6(i)).

4. Discussion and Conclusions

Insulin resistance in hepatocytes is one of the central reasons that block glucose metabolism. Recent findings have indicated the important role of cometabolism between gut microbiota and the organism. But the underlying mechanism is still not fully understood. In the current study, we demonstrated that a metabolite product from gut microbiota, sodium butyrate (NaB), can ameliorate function of hepatocytes via modulating mitochondrial metabolism.

According to a report from Kanazawa and colleagues [1], as high as 19% cases with type 2 diabetes (T2D) are accompanied with liver dysfunction. Concerning the pivotal role of the liver in mediating the metabolism of glucose and lipids, preserving its function helps to inhibit progression of T2D. With the understanding of the influence of gut microbiota towards preserving the organism in a healthy status, effects of the metabolites from microbiota against disease development have attracted more attention. It was found by Qin and colleagues that butyrate-producing bacteria were significantly reduced in a T2D population [4]. Although physiological concentration of butyrate within the liver is low, external administration with butyrate has been suggested to fight against high-fat diet-induced fatty liver [5]; this also suggested potential effects of butyrate against the development of T2D. Previously, we demonstrated in db/db mice that oral administration with NaB could significantly reduce HbA1c and diabetic inflammation [7]; more importantly, hypertrophy and steatosis of hepatocytes in db/db mice were significantly reversed by NaB, accompanied with enhancement of glycogen metabolism [8]. Our findings are in line with a report from Khan and Jena that NaB inhibited liver vascular steatosis and fat deposition [6]. But the underlying mechanism still needs to be fully explored.

Diabetes is closely related with significantly reduced mitochondrial function. In the diabetic population, mitochondrial numbers are found to be reduced [2], lipid oxidation is significantly impaired [3], and a direct relationship between mitochondria and insulin resistance is exhibited [2, 13]. To explore the relationship between NaB and liver function, we firstly carried out a PCR array assay to observe changes in gene expression. We found that NaB administration significantly increased 19 genes while downregulating as many as 35 genes in mitochondria. As most of these genes encode and regulate the composition and function of mitochondria, we further predicted protein-protein interaction between these genes and pathways related with short chain fatty acids by the STRING database. We found that there exists a possible direct relationship between short chain fatty acids and mitochondria, and the content of mitochondria and AMPK pathways is a possible reason that contributes to this relationship.

In the present study, we incubated HepG2 cell with relatively high concentration of insulin to induce insulin resistance. We found that high insulin significantly reduced both the amount and the copy of mitochondrial DNA, and mitochondrial membrane potential was decreased, while application with NaB significantly increased mitochondrial DNA and elevated the membrane potential. Our present findings suggest that NaB could increase the content of mitochondria and ameliorate its dysfunction.

Inevitable by-products of mitochondrial respiration are reactive oxygen species (ROS). In fact, mitochondria themselves contribute to the main production of ROS. Amounts of studies have demonstrated that overaccumulation of ROS and oxidative stress is one of the characteristic of diabetes. Excessive ROS in the absence of sufficient antioxidants will lead to extensive production of oxidative by-products and events, such as generation and accumulation of advanced glycation end products (AGEs), the damage of both nuclear and mitochondrial DNA (mtDNA) [14], and even cell death. Suppression of oxidative stress has been demonstrated to benefit diabetes management. SOD and GPX are two representative antioxidation enzymes. Overexpression of SOD significantly ameliorated insulin resistance in high-fat diet mice [15]. It was interesting in our present study that NaB increased both SOD and GPX expressions and decreased prooxidative NOX2, ROS, and MDA levels. This finding obviously demonstrated that NaB enhanced the function of mitochondria but did not increase the risk of oxidative stress damage.

In fact, production of ATP within mitochondria relies on oxidation. CPT1A, HADH, and ACADS are pivotal rate-limiting enzymes in fatty acid catabolism within mitochondria during β-oxidation [10], and their activities are modulated by histone acetylation and deacetylation. Histone deacetylase (HDAC) directly controls deacetylation modification of histones, and loss of HDAC in the liver will result in increased glycogen storage and reduced blood glucose level [11]. It has been demonstrated that HDAC protein coprecipitated with CPT1A [16]. HDAC3 and HDAC4 are typical HDACs that belong to class I and II HDACs, respectively. Reports indicated that class I HDAC contributed to mitochondrial dysfunction [17] and treatment with its inhibitor promoted energy expenditure and reduced both glucose and insulin levels by increasing PGC-1alpha activity [18]. In the present study, we observed that high insulin significantly inhibited expressions of rate-limiting enzymes of oxidation including ACACs, CPT1A, HADH, and ACADS, while their upstream HDAC was elevated, suggesting the mitochondrial electron transfer chain was blocked under high insulin settings, and NaB application ameliorated their expression. There is a previous study that demonstrated that short chain fatty acids (SCFAs), including NaB, possess a natural inhibitory effect on HDAC [19]. In this sense, NaB may modulate oxidation within mitochondria via inhibiting HDAC.

The GPR43-β-arrestin2 pathway has been demonstrated to mediate the function of NaB [8, 12]. GPR43 is a G protein-coupled protein on the cell membrane, and β-arrestin2 is one of its downstream activators that are usually recognized as a modulator of inflammation. A report has demonstrated that deficiency of β-arrestin2 will lead to insulin resistance [2]. A most recent study from Pydi and colleagues [21] indicated the essential role of β-arrestin2 in maintaining energy homeostasis within adipocytes. Another study also suggested the pivotal function of β-arrestin2 for maintaining euglycemia in hepatocytes [22]. But its involvement in mitochondrial dysfunction under high insulin settings is still not clear. In this study, we demonstrated that high insulin-induced GPR43 and β-arrestin2 reduction was significantly reversed by NaB; more importantly, both the insulin receptor and GLUT2 were upregulated on NaB administration, suggesting the amelioration of insulin resistance and energy metabolism.

Mitochondrial content is influenced by its biogenesis [23], and this process is mainly regulated by peroxisome proliferator-activated receptor coactivator-1alpha (PGC-1alpha) [24]. It was found in diabetic patients that the expression of PGC-1alpha was reduced [25], and upregulation of PGC-1alpha can significantly increase both insulin sensitivity and lipid oxidation [26]. Studies have demonstrated that phosphorylation of AMPK will activate PGC-1alpha, increase expression of mitochondria-related genes [27], and promote mitochondrial biogenesis, while HDAC1 and HDAC3 have been found to repress the transcriptional activity of PGC-1alpha [28] [30]. A recent report from Yoshida and colleagues demonstrated that knockdown of GPR43 will reduce SCFA-induced activation of AMPK [31]. Our findings in this study obviously suggest that NaB promoted the biogenesis of mitochondria via promoting AMPK-PGC1-alpha and blocking the HDAC signaling pathway.

In conclusion, we found in our present study that sodium butyrate administration could significantly promote biogenesis and function of mitochondria under high insulin circumstances, and the GPR43-β-arrestin2-AMPK-PGC1-alpha signaling pathway contributed to these effects (Figure 7). Our present findings obviously provide new insight on the pivotal role of metabolites from microbiota in maintaining euglycemia.

Data Availability

Data in this paper are available on PubMed or Scopus. Any previous paper not accessible could be requested from the corresponding author.

Conflicts of Interest

There is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Acknowledgments

We would like to thank Ms. Lou Chi Han from Macau University of Science and Technology (Macao, China) for the kind suggestion and technical support in this study. This work is supported by the Science and Technology Development Fund of Macau, Macau SAR, China (File Nos.: 0006/2019/A, 0093/2018/A3, and 0025/2019/AGJ) and National Natural Science Foundation of China (81873270).

References

  1. I. Kanazawa, K. Tanaka, and T. Sugimoto, “DPP-4 inhibitors improve liver dysfunction in type 2 diabetes mellitus,” Medical Science Monitor, vol. 20, pp. 1662–1667, 2014. View at: Publisher Site | Google Scholar
  2. R. Boushel, E. Gnaiger, P. Schjerling, M. Skovbro, R. Kraunsøe, and F. dela, “Patients with type 2 diabetes have normal mitochondrial function in skeletal muscle,” Diabetologia, vol. 50, no. 4, pp. 790–796, 2007. View at: Publisher Site | Google Scholar
  3. M. E. Patti, A. J. Butte, S. Crunkhorn et al., “Coordinated reduction of genes of oxidative metabolism in humans with insulin resistance and diabetes: potential role of PGC1 and NRF1,” Proceedings of the National Academy of Sciences of the United States of America, vol. 100, no. 14, pp. 8466–8471, 2003. View at: Publisher Site | Google Scholar
  4. J. Qin, Y. Li, Z. Cai et al., “A metagenome-wide association study of gut microbiota in type 2 diabetes,” Nature, vol. 490, no. 7418, pp. 55–60, 2012. View at: Publisher Site | Google Scholar
  5. G. Mattace Raso, R. Simeoli, R. Russo et al., “Effects of sodium butyrate and its synthetic amide derivative on liver inflammation and glucose tolerance in an animal model of steatosis induced by high fat diet,” PLoS One, vol. 8, no. 7, article e68626, 2013. View at: Publisher Site | Google Scholar
  6. S. Khan and G. Jena, “Sodium butyrate reduces insulin-resistance, fat accumulation and dyslipidemia in type-2 diabetic rat: a comparative study with metformin,” Chemico-Biological Interactions, vol. 254, pp. 124–134, 2016. View at: Publisher Site | Google Scholar
  7. Y. H. Xu, C. L. Gao, H. L. Guo et al., “Sodium butyrate supplementation ameliorates diabetic inflammation in db/db mice,” The Journal of Endocrinology, vol. 238, no. 3, pp. 231–244, 2018. View at: Publisher Site | Google Scholar
  8. W. Q. Zhang, T. T. Zhao, D. K. Gui et al., “Sodium butyrate improves liver glycogen metabolism in type 2 diabetes mellitus,” Journal of Agricultural and Food Chemistry, vol. 67, no. 27, pp. 7694–7705, 2019. View at: Publisher Site | Google Scholar
  9. D. B. Zorov, M. Juhaszova, and S. J. Sollott, “Mitochondrial reactive oxygen species (ROS) and ROS-induced ROS release,” Physiological Reviews, vol. 94, no. 3, pp. 909–950, 2014. View at: Publisher Site | Google Scholar
  10. S. Pucci, M. J. Zonetti, T. Fisco et al., “Carnitine palmitoyl transferase-1A (CPT1A): a new tumor specific target in human breast cancer,” Oncotarget, vol. 7, no. 15, pp. 19982–19996, 2016. View at: Publisher Site | Google Scholar
  11. M. M. Mihaylova, D. S. Vasquez, K. Ravnskjaer et al., “Class IIa histone deacetylases are hormone-activated regulators of FOXO and mammalian glucose homeostasis,” Cell, vol. 145, no. 4, pp. 607–621, 2011. View at: Publisher Site | Google Scholar
  12. S. U. Lee, H. J. in, M. S. Kwon et al., “β-Arrestin 2 mediates G protein-coupled receptor 43 signals to nuclear factor-κB,” Biological & Pharmaceutical Bulletin, vol. 36, no. 11, pp. 1754–1759, 2013. View at: Publisher Site | Google Scholar
  13. D. E. Kelley, K. V. Williams, and J. C. Price, “Insulin regulation of glucose transport and phosphorylation in skeletal muscle assessed by PET,” The American Journal of Physiology, vol. 277, no. 2, pp. E361–E369, 1999. View at: Publisher Site | Google Scholar
  14. F. Song, W. Jia, Y. Yao et al., “Oxidative stress, antioxidant status and DNA damage in patients with impaired glucose regulation and newly diagnosed type 2 diabetes,” Clinical Science, vol. 112, no. 12, pp. 599–606, 2007. View at: Publisher Site | Google Scholar
  15. K. L. Hoehn, A. B. Salmon, C. Hohnen-Behrens et al., “Insulin resistance is a cellular antioxidant defense mechanism,” Proceedings of the National Academy of Sciences of the United States of America, vol. 106, no. 42, pp. 17787–17792, 2009. View at: Publisher Site | Google Scholar
  16. P. Mazzarelli, S. Pucci, E. Bonanno, F. Sesti, M. Calvani, and L. G. Spagnoli, “Carnitine palmitoyltransferase I in human carcinomas: a novel role in histone deacetylation?” Cancer Biology & Therapy, vol. 6, no. 10, pp. 1606–1613, 2007. View at: Publisher Site | Google Scholar
  17. B. Lkhagva, Y. H. Kao, T. I. Lee, T. W. Lee, W. L. Cheng, and Y. J. Chen, “Activation of class I histone deacetylases contributes to mitochondrial dysfunction in cardiomyocytes with altered complex activities,” Epigenetics, vol. 13, no. 4, pp. 376–385, 2018. View at: Publisher Site | Google Scholar
  18. A. Galmozzi, N. Mitro, A. Ferrari et al., “Inhibition of class I histone deacetylases unveils a mitochondrial signature and enhances oxidative metabolism in skeletal muscle and adipose tissue,” Diabetes, vol. 62, no. 3, pp. 732–742, 2013. View at: Publisher Site | Google Scholar
  19. M. Göttlicher, S. Minucci, P. Zhu et al., “Valproic acid defines a novel class of HDAC inhibitors inducing differentiation of transformed cells,” The EMBO Journal, vol. 20, no. 24, pp. 6969–6978, 2001. View at: Publisher Site | Google Scholar
  20. B. Luan, J. Zhao, H. Wu et al., “Deficiency of a beta-arrestin-2 signal complex contributes to insulin resistance,” Nature, vol. 457, no. 7233, pp. 1146–1149, 2009. View at: Publisher Site | Google Scholar
  21. S. P. Pydi, S. Jain, W. Tung et al., “Adipocyte β-arrestin-2 is essential for maintaining whole body glucose and energy homeostasis,” Nature Communications, vol. 10, no. 1, p. 2936, 2019. View at: Publisher Site | Google Scholar
  22. L. Zhu, M. Rossi, Y. Cui et al., “Hepatic β-arrestin 2 is essential for maintaining euglycemia,” The Journal of Clinical Investigation, vol. 127, no. 8, pp. 2941–2945, 2017. View at: Publisher Site | Google Scholar
  23. D. A. Hood, L. D. Tryon, H. N. Carter, Y. Kim, and C. C. W. Chen, “Unravelling the mechanisms regulating muscle mitochondrial biogenesis,” The Biochemical Journal, vol. 473, no. 15, pp. 2295–2314, 2016. View at: Publisher Site | Google Scholar
  24. C. Ploumi, I. Daskalaki, and N. Tavernarakis, “Mitochondrial biogenesis and clearance: a balancing act,” The FEBS Journal, vol. 284, no. 2, pp. 183–195, 2017. View at: Publisher Site | Google Scholar
  25. V. K. Mootha, C. M. Lindgren, K. F. Eriksson et al., “PGC-1alpha-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes,” Nature Genetics, vol. 34, no. 3, pp. 267–273, 2003. View at: Publisher Site | Google Scholar
  26. C. R. Benton, G. P. Holloway, X. X. Han et al., “Increased levels of peroxisome proliferator-activated receptor gamma, coactivator 1 alpha (PGC-1alpha) improve lipid utilisation, insulin signalling and glucose transport in skeletal muscle of lean and insulin-resistant obese Zucker rats,” Diabetologia, vol. 53, no. 9, pp. 2008–2019, 2010. View at: Publisher Site | Google Scholar
  27. S. Jager, C. Handschin, J. St-Pierre, and B. M. Spiegelman, “AMP-activated protein kinase (AMPK) action in skeletal muscle via direct phosphorylation of PGC-1alpha,” Proceedings of the National Academy of Sciences of the United States of America, vol. 104, no. 29, pp. 12017–12022, 2007. View at: Publisher Site | Google Scholar
  28. G. Canettieri, I. Morantte, E. Guzmán et al., “Attenuation of a phosphorylation-dependent activator by an HDAC-PP1 complex,” Nature Structural Biology, vol. 10, no. 3, pp. 175–181, 2003. View at: Publisher Site | Google Scholar
  29. S. Grégoire, L. Xiao, J. Nie et al., “Histone deacetylase 3 interacts with and deacetylates myocyte enhancer factor 2,” Molecular and Cellular Biology, vol. 27, no. 4, pp. 1280–1295, 2007. View at: Publisher Site | Google Scholar
  30. C. Handschin, J. Rhee, J. Lin, P. T. Tarr, and B. M. Spiegelman, “An autoregulatory loop controls peroxisome proliferator-activated receptor gamma coactivator 1alpha expression in muscle,” Proceedings of the National Academy of Sciences of the United States of America, vol. 100, no. 12, pp. 7111–7116, 2003. View at: Publisher Site | Google Scholar
  31. H. Yoshida, M. Ishii, and M. Akagawa, “Propionate suppresses hepatic gluconeogenesis via GPR43/AMPK signaling pathway,” Archives of Biochemistry and Biophysics, vol. 672, article 108057, 2019. View at: Publisher Site | Google Scholar

Copyright © 2020 Tingting Zhao et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views644
Downloads373
Citations

Related articles

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.