BioMed Research International

BioMed Research International / 2016 / Article

Research Article | Open Access

Volume 2016 |Article ID 5675084 | 11 pages | https://doi.org/10.1155/2016/5675084

Identification of ITGA2B and ITGB3 Single-Nucleotide Polymorphisms and Their Influences on the Platelet Function

Academic Editor: Robert Baiocchi
Received03 Feb 2016
Accepted18 Apr 2016
Published14 Nov 2016

Abstract

The aim of the study was to investigate ITGA2B and ITGB3 genetic polymorphisms and to evaluate the variability in the platelet function in healthy Chinese subjects. The genetic sequence of the entire coding region of the ITGA2B and ITGB3 genes was investigated. Adenosine diphosphate-induced platelet aggregation, glycoprotein IIb/IIIa content, bleeding time, and coagulation indexes were detected. Thirteen variants in the ITGA2B locus and 29 variants in the ITGB3 locus were identified in the Chinese population. The rs1009312 and rs2015049 were associated with the mean platelet volume. The rs70940817 was significantly correlated with the prothrombin time. The rs70940817 and rs112188890 were related with the activated partial thromboplastin time, and ITGB3 rs4642 was correlated with the thrombin time and fibrinogen. The minor alleles of rs56197296 and rs5919 were associated with decreased ADP-induced platelet aggregation, and rs55827077 was related with decreased GPIIb/IIIa per platelet. The rs1009312, rs2015049, rs3760364, rs567581451, rs7208170, and rs117052258 were related with bleeding time. Further studies are needed to explore the clinical importance of ITGA2B and ITGB3 SNPs in the platelet function.

1. Introduction

Platelet aggregation plays a central role in the pathogenesis of acute thrombosis in coronary heart disease, stroke, and peripheral arterial disease. The cellular events leading to platelet aggregation are mediated by the binding of fibrinogen to the glycoprotein (GP)IIb/IIIa receptor of platelets as a final common pathway. GPIIb/IIIa is a platelet-specific, surface membrane receptor and also called alpha IIb beta 3 (aIIb β3) in the integrin nomenclature and thus plays a primary role in both platelet adhesion and thrombus formation at the vascular injury site [1]. A large interindividual number variability for GPIIb/IIIa receptors expressed on the platelet surface is commonly observed [2, 3]. Moreover, a defect in the GPIIb/IIIa complex or a qualitative abnormality of this complex is seen in Glanzmann’s thrombasthenia patients with impaired platelet aggregation and increased bleeding [4].

The ITGA2B gene encodes the aIIb subunit (GPIIb), whereas the ITGB3 gene encodes β3 (GPIIIa). The ITGA2B spanning 17 kb has 30 exons, whereas the ITGB3 spanning 46 kb has 15 exons; they are closely located on chromosome 17q21.32 without evidence for coordinated expression [5]. A few studies have linked single-nucleotide polymorphisms (SNPs) in ITGA2B and ITGB3 with increased or decreased platelet responses to various agonists and the risk of acute coronary syndrome and atherosclerosis [68].

A common polymorphism in the ITGB3, known as the human platelet antigen 1 (HPA-1b, PlA2, or rs5918), arises from a single-nucleotide change at position 1565 in Exon2 of ITGB3, resulting in a leucine (PlA1) to proline (PlA2) substitution at residue 33 [9]. The SNP has been extensively studied as an inherited risk factor for acute coronary syndrome and for its effect on the platelet function [68]. The HPA-3 (rs5910) polymorphism results from a thymine to guanine base change that leads to the replacement of isoleucine (HPA-3a) by serine (HPA-3b) at codon 843 of GPIIb (ITGA2B). This polymorphism may potentially influence the activity of the GPIIb/IIIa complex and associate with thrombosis [10].

According to the aforementioned studies, GPIIb/IIIa was believed to be a platelet-platelet contact receptor playing an important role in platelet aggregation, and its SNPs were associated with platelet hyperreactivity and have an effect on the pharmacodynamics of antiplatelet drugs. However, limited information was available on other genetic polymorphisms of ITGA2B and ITGB3 in Asian populations or their association with the platelet function [11, 12]. Moreover, the prevalence of the PlA2 allele (rs5918) is dependent on ethnicity, with a frequency of approximately 15/100 in Caucasian populations [13] falling to less than 1/100 in Oriental populations [12, 14].

In this study, regions of the exons of ITGA2B and ITGB3 genes were sequenced in 86 unrelated healthy Chinese. In addition, the association between genetic variants of ITGA2B and ITGB3 exons and the adenosine diphosphate- (ADP-) induced platelet aggregation, GPIIb/IIIa content, bleeding time, and coagulation indexes was investigated in 55 of the 86 subjects.

2. Materials and Methods

2.1. Study Design

The research was conducted in compliance with the Declaration of Helsinki. The study protocol was approved by the Ethical Review Board of the Peking University First Hospital. All subjects gave their written informed consent prior to participation in the study. Healthy native Chinese subjects () between 18 and 45 years of age with a body mass index (BMI) of 19–24 kg/m2 were included in the study, and their genotypes were unknown.

All the subjects were considered healthy on the basis of their medical history, physical examination, vital signs (blood pressure, pulse rate, and temperature), safety laboratory tests (blood chemistry, hematological tests, and urinalysis), and 12-lead electrocardiography.

The ADP-induced platelet aggregation (transmission, max), GPIIb/IIIa content (GPIIb/IIIa per platelet), bleeding time, and coagulation indexes, including the mean platelet volume (MPV), platelet count (PLT), prothrombin time (PT), activated partial thromboplastin time (aPTT), fibrinogen (FIB), and thrombin time (TT) were detected in 55 of the 86 subjects. None of the donors had taken any medication for 2 weeks before blood collection.

2.2. ADP-Induced Platelet Aggregation

Blood was collected in 3.8% sodium citrate tubes, and platelet-rich plasma (PRP) was obtained by centrifuging blood at 1000 revolutions per minute (rpm) for 10 minutes at room temperature. The PRP was collected in a fresh tube and platelet was counted by Platelet Counter PL100 (Sysmex, Kobe, Japan). Platelet-poor plasma (PPP) was obtained by centrifuging the remaining blood at 3000 rpm for 10 minutes at room temperature, and platelet numbering PRP was adjusted to 250 × 109/L by PPP. Detection was completed within 1 hour after sampling.

Platelet aggregation was determined by the turbidimetric method using 20 umol/L ADP as the agonist. After zero setting with the PPP, assays were performed in platelet-rich plasma in a Chrono-Log aggregometer. Platelet aggregation was quantified as the maximum change in light transmission occurring within 5 minutes of addition of agonist.

2.3. GPIIb/IIIa Content

GPIIb/IIIa on the platelet surface was evaluated in the PRP as the maximal binding of a 125I-labeled GPIIb/IIIa integrin antiplatelet antibody F(ab)2 [15]. The PRP was fixed with equal volume of anticoagulant-fixative solution (10 mmol/L EDTA-Na2, 0.2% glutaraldehyde, and 0.02% sodium azide dissolved in PBS, pH 7.4). After stored at 4°C, overnight, platelet was washed by Tyrode’s solution twice and resuspended in Tyrode solution, containing 0.35% bovine serum albumin (concentration adjusted to 1 × 1011 platelets/L), and sodium azide was added at final concentration of 0.02% (V/V) to preserve the platelet at 4°C for a week-long before assay. For detection, the platelet suspension (100 μL) was added to a 0.5 mL Eppendorf tube and then incubated with 100 μL of antibody (containing 20,000 cpm of labeled monoclonal antibody (McAb) and 0.8 μg of unlabeled McAb) at 37°C for 1 hour, after washed with 0.35% bovine serum albumin/Tyrode’s solution for three times. The radioactivity count of the precipitate in the tube was measured. Assuming that one monoclonal antibody would only bind one GP molecule on the platelet membrane, the number of GP molecules on the platelet membrane was calculated as number of GP molecules/platelet = (binding rate × amount of antibody (g) × Avogadro’s number)/(molecular weight of antibody × platelet count).

2.4. Bleeding Time

The skin bleeding time was carried out using the Simplate-II device (General Diagnostics, NJ, USA). A sphygmomanometer cuff was inflated on the patient’s arm to 40 mmHg. The arm was supported at the level of the heart, and a muscular area on the volar aspect distal to the antecubital area was identified and swabbed with alcohol. The Simplate-II device was used to perform the incision perpendicular to the antecubital fossa. Blood was blotted with sterile filter paper every 30 seconds until blood no longer stained the paper. The time from incision to stopping of bleeding was recorded.

2.5. Genetic Analysis

Genomic DNA was extracted from peripheral whole blood samples of each subject using a DNA Purification Kit (Wizard; Promega, WI, USA). After the polymerase chain reaction (PCR) products were obtained, all samples were directly sequenced to determine the SNPs in ITGA2B and ITGB3 (Life Technologies Biotechnology Co., Ltd., China).

Primers required for PCR amplification and sequencing were designed according to the wild-type ITGA2B and ITGB3 sequences reported in the GenBank (NG_008331.1 and NG_008332.1, resp.). Tables 1 and 2 describe the primer pairs used to amplify the promoters, the 5′- and 3′-untranslated regions (UTRs), the entire coding regions and the intron-exon junctions of the ITGA2B and ITGB3 genes.


Sequence number obtained in this studydbSNPLocationNC_000017.11NM_000419.3Nucleotide changeNP_000410.2 amino acid changeMA(F)H-W

ITGA2B-01rs37603645′ upstream end44390436-963ctcccaaggg A/T ctcatttacaT(0.052)0.609
ITGA2B-02New5′ upstream end44390152-679tagaccaagg T/C ccattcaccaC(0.006)0.957
ITGA2B-03New5′ upstream end44390081-608caagacggag G/A aggagtgaggA(0.006)0.957
ITGA2B-04NewExon344385910354tgatgagacc C/T gaaatgtaggArg108StopT(0.006)0.957
ITGA2B-05NewExon13443809601344ctcccaggtc C/A tggacagcccLeu438MetA(0.006)0.957
ITGA2B-06rs201355504Intron13443808211393+58cttggcactt C/T cagcgaatgtA(0.006)0.957
ITGA2B-07NewExon14443806381401tagacctgat C/G gtgggagcttIle467MetG(0.006)0.957
ITGA2B-08rs850730Intron21443770952188-7C>Gccctcctcat C/G tcccagatagG(0.477)0.289
ITGA2B-09NewExon23443763362320cgtgccggtc C/T gggcagaggcArg774TrpT(0.006)0.957
ITGA2B-10rs117870452Exon23443763222334gcagctccac C/T tgggcctctgGln778=G(0.012)0.913
ITGA2B-11rs5911Exon26443756972621T>Gggggctgggg A/C tgggcagcccIle874SerG(0.477)0.289
ITGA2B-12rs5910Exon30443724213063C>Tacccccaggt C/T ggcttcttcaVal1021=T(0.465)0.289
ITGA2B-13New3′-UTR44372213151C>Agctacccccc C/A tcctgctgccA(0.017)0.869

dbSNP, single nucleotide polymorphism database; H-W , Hardy–Weinberg equilibrium value; MA(F), minor allele (frequency); GP, glycoprotein.
SNPs which related with bleeding time in this study.

DNA sequence numberAmplified or sequenced regionForward primer (5′ to 3′)Reverse primer (5′ to 3′)Amplified region NC_000017.11Length (bp)

ITGA2B-1TCCTCCTCTTCCGCTTACCGTACTACCACCGTGCTAGTCC44389728–44390630848
ITGA2B-2Exon1CCAATATGGCTGGTTGAGAACTTCCCTTACGGCTCA44389267–44390059792
ITGA2B-3Exon1CCAGTGCAGCTCACCTTCTAGATGAGGGAAATGGAACAGA44388253–443893681115
ITGA2B-4Intron1TATGAACCACTCCACCCTTTGGCACTCTTGATTCTG44388169–44389006837
ITGA2B-5Exon2, Exon3ACCGCTGGTTCTTGTTGCCCTACGGGCGTCTTCTCA44385649-44386479830
ITGA2B-6Exon4–Exon6TACAGGGCACAGGGAACAATCAGAGGCTCTGGGAGGACACG44384990–44385810820
ITGA2B-7Exon7, Exon8TCCTGGCGGCTATTATTTCTGCACCGACGACATATTCTGG44384339–44385186847
ITGA2B-8Exon9–Exon11ATTTGCGCCCTTGTCCTCAGCCGAATCGCCCATAGA44383538–443846051067
ITGA2B-9Exon12CCCTCTGTCTCCCTTTCCCATCCAGTCTCCCACCAA44383189–44383838649
ITGA2B-10Exon13, Exon14CCTAGTCTCCTGGGATGTTCTCACGGGTGTCTTGGTCT44380390–44381163773
ITGA2B-11Exon14–Exon17TAATCGCCAATTCTGACCCCACATCCCACCTTCTCCTG44379854–44380682828
ITGA2B-12Exon18ACCCACTGGACTTGTTCATCTGTGACTTGGCACTAACCC44379610–44379957347
ITGA2B-13Exon19, Exon20TGGACGACAGAGCGAGACGGCCATACCTCGACATTG44378354–44378989635
ITGA2B-14Exon21CATGTGACAGTCCCTTGAAAAGTCACTCACCCAAGGA44377551–44377933382
ITGA2B-15Exon22CTTGGAGGGTGAAGACTGGCAACTCCTGACCTCCAGTGA44376833–44377179346
ITGA2B-16Exon23–Exon25CCAGGTCTAACTTCAGTGTGGCTCTGGCAGGAAGATCTGT44375629–44376523894
ITGA2B-17Exon26TCCGACCTGCTCTACATCCCGGGCTTGCTCACATAGTC44375277–44375913636
ITGA2B-18Exon27, Exon28ATGACCCTCCCTGCATCTCCACCTTGACACCTGCCTTT44374500–44375317817
ITGA2B-19Exon29GCACGCATGGTTCAACGTCCTCCCGAGTAGCTGAGATT44374025–44374731706
ITGA2B-20Exon30AAAGGCATCCATTTGTGATGTTGGTAAGGCTGGTCTC44371896–44372566670
ITGB3-1CAGGAGGTGGAGGATTGTGCTGGATTCTTGGGACAC47252637–47253474837
ITGB3-2Exon1CGGTTCAGAGAAGGCATTCAGGCTCCAAGTCCGCAACTTGA47253373–47254015642
ITGB3-3Intron1TTGGCGTAGGAGGTGAGTGACCGCAGGAAGCCAAGTTGAA47253929–47254518589
ITGB3-4Intron1TTGGCGTAGGAGGTGAGTGAGGAAGTTGCAGTGAGCCGAGAA47253929–472550631134
ITGB3-5Exon2ATTGGGAAAGTTGGGAAGGGAAAGGGCAGCAGTGGTT47274335–47274773438
ITGB3-6Exon3AGGCTGGTCTTGAACTCTTGCTCCACCTTGTGCTCTAT47283116–47283612496
ITGB3-7Exon4GGGCTTTCTGGTTTGCTTCATTTCCCTCCCATTCTC47284329–47284978649
ITGB3-8Exon5TGTCTGGGTAACTGTGGTCATCTGCCTACTTTGCTG47286124–47286725601
ITGB3-9Exon6TCCAAGGACTGGGACTGAATGATGCTGCTGCTATGC47286919–47287483564
ITGB3-10Exon7, Exon8AGCCCAAGCAAGATAAGTGGAGAAGGCAGTAAGACC47289597–47290393796
ITGB3-11Exon9AAACTGGGCTCCAATAACTGAGGGACTGAAGGTAAAG47290561–47291406845
ITGB3-12Exon10CAGGGCAGGGAACAACTTGGATTGGTCCTTATACTCAAAA47292050–47292720670
ITGB3-13Exon11GAGCAAGTCCTGCCATACTCACAGAGTGTCCTCCATAA47299101–47299890789
ITGB3-14Exon12CAGAAATGGCATAGGGTTTCTTGCTGAGTCTGTGGG47300168–47300824656
ITGB3-15Exon13CTTGAATCTAGGCATCGTGTATTGAACTCCTGACCC47302581–47303050469
ITGB3-16Exon14CCTCAAGTAGGTCCCAGTGAACATGACCACCCAAAGC47307158–47307721563
ITGB3-17Exon15CTCATCTCCTCCTGTTATTTTGACATTCTCCCAACCTAC47309941–47310337396

2.6. Data Analysis

The Variant Reporter v1.1 (Life Technologies Biotechnology Co., Ltd.) software suite was used for the initial analysis of the sequence, including base calling, fragment assembly, SNP, and sequence insertions/deletions detection. Polymorphisms of ITGA2B and ITGB3 genes were named according to the genomic reference sequences NG_008331.1 and NG_008332.1, respectively. Novel SNPs were named as ITGA2B-number or ITGB3-number in the present study.

2.7. Statistical Analysis

The association between two parameters was assessed by Pearson’s two-tailed test. Statistical analyses were performed using the Statistical Package for Social Sciences software program for Windows (SPSS version 16.0). A value of 0.05 was considered significant.

3. Results

3.1. ITGA2B and ITGB3 Variations

Within the Chinese sample, 13 and 29 variants in ITGA2B and ITGB3 were identified, respectively. Two novel ITGB3 SNPs with MA(F) > 0.02 were found, which were not reported in the National Center for Biotechnology Information (NCBI) dbSNP database (https://www.ncbi.nlm.nih.gov/snp/). The allele frequencies and Hardy–Weinberg equilibrium test results of the identified polymorphic sites are shown in Tables 3 and 4.


Sequence number obtained in this studydbSNPLocationNC_000017.11NM_000212.2Nucleotide changeNP_000410.2 amino acid changeMA(F)H-W

ITGB3-01rs1473633515′-UTR47253042-820agcttccaga G/A gttttaagtcA(0.012)0.913
ITGB3-02rs38098625′-UTR47253062-800ctggggaaga C/T ccagggactcT(0.424)0.822
ITGB3-03rs72081705′-UTR47253393-469aaggcattca G/A cagatgtttgA(0.419)0.680
ITGB3-04New5′-UTR47253360-502tagtgaataa T/A aaaggactgaA(0.023)0.913
ITGB3-05rs72080555′-UTR47253461-401gtgaatgtgt C/A ccaagaatccA(0.221)0.273
ITGB3-06rs558270775′-UTR47253717-145tagagaagcc G/C gaggggaggaC(0.448)0.494
ITGB3-07rs5675814515′-UTR47253771-91acccaccgcg -/TCCCC tcccctccccinsTCCCC(0.058)0.567
ITGB3-08rs1170522585′-UTR47253855-7cgcgggaggc G/C gacgagatgcC(0.227)0.771
ITGB3-09NewExon14725388221ggccgcggcc C/G cggccgctctPro7=G(0.407)0.567
ITGB3-10rs11871251Intron14725406179+121ctgggaatgc G/A cgtgtcctggA(0.453)0.771
ITGB3-11NewIntron14725408279+152tggcgcggt C/G ggagccgggaG(0.012)0.913
ITGB3-12rs112188890Intron14725410179+161gagctgggga C/T cttcctggccT(0.116)0.864
ITGB3-13rs117414137Intron14725419279+252aggctgagcg C/G cttcccggccG(0.116)0.864
ITGB3-14rs11871447Intron14725425279+312ccgcgctcac C/G cggggctgcgG(0.448)0.918
ITGB3-15NewIntron14725433179+391tggggcttcc G/A ggggttgttcA(0.006)0.957
ITGB3-16rs1009312Intron14725477479+834ggcacagccc G/A gggttgctgcG(0.471)0.000
ITGB3-17rs2015049Intron14725486579+925ggccgcctct G/A cctcagaggaA(0.529)0.000
ITGB3-18rs56197296Intron547287025_47287029778-45_778-41catggctgaa TTTGT/- tttgtctcctdelTTTGT(0.169)0.049
ITGB3-19rs5919Exon647287174882ttgtccagcc T/C aatgacgggcPro294=C(0.262)0.022
ITGB3-20rs41504748Intron7472901451036-40accaccagct T/C cctttggtaaC(0.070)0.334
ITGB3-21rs15908Exon9472909711143cttccagctc A/G/T actttagaacVal381=C(0.599)0.006
ITGB3-22NewExon10472921771299gaggctgtcc C/T caggagaaggPro433=T(0.006)0.957
ITGB3-23rs4642Exon10472924111533A>Gcagcaggacga A/G tgcagcccccGlu511=G(0.331)0.214
ITGB3-24rs13306487Exon10472924221544tgcagccccc A/C/G ggagggtcagArg515GlnA(0.012)0.913
ITGB3-25rs4634Exon10472924231545gcagcccccg G/A gagggtcagcArg515=A(0.331)0.214
ITGB3-26NewExon10472925281659gcgagtgtga C/TgacttctcctAsp550=T(0.006)0.957
ITGB3-27rs149823724Exon11472995191902cagatgcctg C/T acctttaagaCys634=T(0.006)0.957
ITGB3-28rs11870252Intron11473004591914-19ccttaatcac T/C gtgtcctctcC(0.035)0.869
ITGB3-29rs70940817Exon12473005241960cctacatgac G/A aaaatacctgGlu654LysA(0.076)0.432

dbSNP, single nucleotide polymorphism database; H-W , Hardy–Weinberg equilibrium value; MA(F), minor allele (frequency).
SNPs which related with ADP induced platelets aggregation, GPIIb/IIIa content, bleeding time, or coagulation indexes in this study.

dbSNPGenotypesAggregation max GPIIb-IIIa per plateletBleeding time (s)PLT (109/L)MPV (fL)

rs3760364AA48
AT7
0.1480.4330.0380.5120.911
rs7208170GG18
GA24
AA13
0.2290.1050.0300.4280.051
rs55827077GG18
GC22
CC14
0.0910.0210.4010.2510.141
rs567581451-/-49
-/insTCCCC6
0.6090.9990.0400.4280.054
rs117052258GG29
GC21
CC4
0.1650.5390.0280.7640.288
GG19
GA22
AA14
0.1890.1600.0270.9440.029
rs56197296TTTGT/TTTGT42
TTTGT/del11
del/del2
0.0140.9160.6950.4330.416
rs5919TT31
TC16
CC8
0.0150.6340.1300.7280.148

Note: Pearson’s two-tailed test was used to analyze correlation between genotype and parameter. rs1009312 was completely linked with rs2015049.
3.2. Linkage Disequilibrium Analysis

Using the detected polymorphisms greater than 0.01 in frequency [MA(F) > 0.02], linkage disequilibrium (LD) was analyzed for and values (Figure 1). For ITGA2B, rs5911 was completely linked with rs850730 (), and rs5910 was strongly linked with rs850730 and rs5911 (). For ITGB3, complete LD was observed between rs4642 and rs4634 (). Other LD results are shown in Figure 1. A new SNP ITGB3-09 was found for which MA(F) in this study was 0.402.

The Hardy–Weinberg equilibrium values of rs1009312 and rs2015049 were <0.001. The possible reason is that the sample in this study may have a Chinese population of other ethnic groups besides the Han population. Those two SNPs were not included in the LD analysis.

3.3. Correlation of ADP-Induced Platelet Aggregation, GPIIb/IIIa Content, Bleeding Time, and Coagulation Indexes

The GPIIb/IIIa contents, present as average numbers of GPIIb/IIIa receptor in each platelet, were associated with ADP-induced platelet aggregation (, ), PLT (, ), PT (, ), and TT (, ) (Figures 1 and 2). The relationship between GPIIb/IIIa content and APTT was not significant (, ), while the association between ADP-induced platelet aggregation and APTT was moderately significant (, ) (Figure S1). The bleeding time had no association with other parameters. It had a negative association trend with MPV but was not significant (, ). The PLT was associated with PT (, ) and TT (, ). The FIB was negatively correlated with TT (, ).

3.4. Impact of ITGA2B and ITGB3 SNPs on ADP-Induced Platelet Aggregation, GPIIb/IIIa Content, Bleeding Time, and Coagulation Indexes

For ITGA2B, only one SNP rs3760364 was related with the bleeding time () (Table 4). No significant correlation or trend was observed between ITGA2B SNPs and other parameters.

For ITGB3, the mean values of ADP-induced platelet aggregation of homozygous mutant genotypes in rs56197296 and rs5919 were lower than those of heterozygous mutations and wild type. Moreover, the GPIIb/IIIa per platelet was associated with rs55827077. A trend of GPIIb/IIIa per platelet was observed among rs70940817 GG (45), GA (9), and AA (1) carriers (, , 61277, resp., ), although it did not reach a significant level. The bleeding time was significantly related with rs3760364, rs7208170, rs567581451, and rs117052258 (Table 4).

In the present study, SNPs related with PLT were not found. ITGB3 rs1009312, which is completely linked with rs2015049, was significantly associated with the MPV (Table 4). ITGB3 rs70940817 was correlated with the PT and APTT ( and , resp.). The coagulation indexes and their values are summarized in Table 5.


GenotypesPT (s)APTT (s)TT (s)FIB (g/L)

CC42
CT12
TT112.536.716.52.72
0.1260.0290.2990.173
AA27
AG21
GG7
0.7700.0880.0150.029
rs70940817GG45
GA9
AA112.737.215.753.10
0.0020.0030.0780.069

MPV, mean platelet volume; PLT, platelet count; PT, prothrombin time; APTT, activated partial thromboplastin time; FIB, fibrinogen; TT, thrombin time.
Note: Pearson’s two-tailed test was used to analyze correlation between genotype and parameter.
Strong LD was observed between rs112188890 and rs117414137 (); completely LD was observed between rs4642 and rs4634.

4. Discussion

In this study, 13 variants in the ITGA2B locus and 29 variants in the ITGB3 locus in the Chinese population were observed. Two of the 29 variants located in ITGB3 were novel SNPs with MA(F) > 0.02. Variants in ITGA2B and ITGB3 genes displayed significant interethnic differences in the global populations (Table 6). The C allele frequency of SNP rs5918 (T/C), located in the ITGB3 gene, was only inhomogeneously distributed at 0.7% in the Chinese population, while it is common in whites and Africans (allele frequency 13.7% versus 12.8%). The following alleles of SNPs, rs7208170A, rs55827077C, rs11871251A, rs1009312G, and rs2015049G, were found to be more common in the Han Chinese and Africans (37%~50%) than in the European ancestry (10%~20%). In the ITGA2B gene, the rs5911 was completely linked with rs850730 and strongly linked with rs5910 in the Chinese population in this study, and all the three SNPs were common in whites and Asians. However, the rs5911 was not found in Africans. According to the ethnicity difference described in the preceding text, resequencing of the ITGA2B and ITGB3 genes in the Chinese population was believed to be very important to reveal the function of SNPs.


dbSNP
NumberThis study Chinese

ITGA2B-01rs3760364T(0.052)T(0.012)T(0)T(0)
ITGA2B-08rs850730G(0.477)G(0.467)G(0.297)G(0.437)
ITGA2B-11rs5911G(0.477)G(0.467)G(0.305)G(0)
ITGA2B-12rs5910T(0.465)T(0.442)T(0.376)T(0.432)
ITGB3-03rs7208170A(0.419)A(0.496)A(0.194)A(0.431)
ITGB3-05rs7208055A(0.221)A(0.225)A(0.117)A(0.356)
ITGB3-06rs55827077C(0.448)C(0.417)C(0.158)C(0.39)
ITGB3-08rs117052258C(0.227)C(0.208)NANA
ITGB3-10rs11871251A(0.453)A(0.482)A(0.199)A(0.373)
ITGB3-12rs12188890T(0.116)T(0)T(0.023)T(0)
ITGB3-16rs1009312G(0.417)A(0.434)A(0.125)A(0.432)
ITGB3-17rs2015049G(0.471)A(0.478)A(0.138)A(0.413)
NF.rs5918C(0)C(0.007)C(0.137)C(0.128)
ITGB3-18rs56197296delTTTGT
(0.169)
NANANA
ITGB3-19rs5919C(0.262)C(0.232)C(0.049)C(0.187)
ITGB3-23rs4642G(0.331)G(0.31)G(0.283)G(0.306)
ITGB3-25rs4634A(0.331)A(0.350)A(0.283)A(0.331)
ITGB3-29rs70940817A(0.076)NANANA

dbSNP, single nucleotide polymorphism database; MA(F), minor allele (frequency); SNP, single nucleotide polymorphisms; NF, not found; NA, not available.
Resource of MP(F)s was from GenBank and HapMap, https://www.ncbi.nlm.nih.gov/snp/; Han Chinese in Beijing, China (CHB), or CHB + Japanese in Tokyo, Japan (JPT), if there is no CHB data in the SNP; Utah residents with Northern and Western European ancestry from the CEPH collection (CEU); Yoruba in Ibadan, Nigeria (YRI).

Variation in the MPV or PLT can have a profound impact on differences in the platelet function between individuals [16, 17], and these traits have a strong genetic component [1821]. However, limited information is available for Asians. In the present study, the A alleles of rs1009312 and rs2015049, located in ITGB3, were positively associated with the MPV (). The MPV had a trend in rs7208170 alleles but did not reach a significant level (). The difference between PLT and SNPs in ITGA2B or ITGB3 was not significant.

The APTT and PT are clinical tests commonly used to indicate coagulation factor deficiencies [22, 23], activated coagulation, and risk of venous thromboembolism [24, 25]. To date, two genome-wide association studies (GWAS) of APTT and PT conducted in the European ancestry have been reported. One study identified genome-wide significant associations of APTT and variants at F12 (MIM 610619), KNG1 (MIM 612358), and HRG (MIM 142640) [26]. In the other research, the GWAS for APTT and PT was conducted and replicated genome-wide significant associations at KNG1, HRG, F11, F12, and ABO for APTT and identified significant associations at the F7 and PROCR/EDEM2 regions for PT. Eight genetic loci accounted for ~29% of the variance in APTT, and two loci accounted for ~14% of the variance in PT [27]. In this study, the association of APTT, PT, FIB, and TT with ITGA2B and ITGB3SNPs was investigated. The A allele of ITGB3 rs70940817 was found to significantly correlate with the elevated APTT and PT ( and , resp.). The T allele of ITGB3 rs112188890 was related with APTT (), and the G allele of ITGB3 rs4642 was associated with TT and FIB ( and , resp.).

The ADP-induced platelet aggregation test was often used to identify the platelet function and the efficacy of antiplatelet drugs. Jones et al. detected 1327 SNPs and investigated their correlation with ADP or collagen-related peptide-induced platelet aggregation in 500 healthy northern European subjects. This identified 17 novel associations with the platelet function () accounting for approximately 46% of the variation in response [28]. In this study, the minor allele of rs56197296 and rs5919 was found to be associated with the decreased ADP-induced platelet aggregation ( and , resp.).

GPIIb/IIIa is the central receptor of platelet aggregation. The variations of GPIIb/IIIa amount expressed on a platelet surface might affect the platelet-aggregating activity. Many studies reported that the rs5918 correlated with the GPIIb/IIIa receptor expression [29]; however, many conflict studies have also been published [3, 30]. O’Halloran et al. investigated whether three polymorphisms of the GPIIIa promoter (−468G/A, −425A/C, and −400C/A) influenced the RNA expression and receptor density in the platelets of patients with cardiovascular disease [3]. They found a threefold variation between the subjects in the number of GPIIb/IIIa receptors expressed per platelet, although no association between the receptor density and the PlA2 or the three promoter polymorphisms was demonstrated. In the present study, rs55827077, which was located at the promoter region of the GPIIIs gene at position −145, was related with GPIIb/IIIa per platelet.

The bleeding time is a test that evaluates the platelet function in vivo. A prolonged bleeding time can result from platelet abnormality, Von Willebrand factor deficiency, or vascular disorders such as Ehlers–Danlos syndrome. A disruption of platelet aggregation results in a prolongation of the bleeding time [31]. In this study, the bleeding time was related with rs3760364 of ITGA2B and rs7208170, rs567581451, and rs117052258 of ITGB3 (). No previous study reporting on the effect of SNPs on the bleeding time was found. The mechanism of the relationship needs to be further examined. However, a negative trend between the bleeding time and MPV (, ) was observed. Moreover, rs1009312 and rs2015049 were found to significantly associate with both bleeding time and MPV. Further, the minor alleles of rs7208170 and rs567581451, which were significantly related with the bleeding time, had a trend with the MPV among genotypes, although they did not reach a significant level ( and , resp.). However, no relationship was observed among SNPs, bleeding time, and MPV in rs3760364 and rs117052258.

In this study, a positive correlation of the level of ADP-induced aggregation and GPIIb/IIIa content was detected in healthy volunteers. This correlation is consistent with a previous report. Yakushkin et al. investigated the relationship between the number of GPIIb/IIIa and the level of ADP-induced aggregation in a group of 35 healthy volunteers and found positive and significant correlations between the level of platelet aggregation induced by different ADP doses (from 1.25 to 20 mmol/L) and the number of GPIIb/IIIa [32].

A strong positive correlation was observed between GPIIb/IIIa per platelet and PLT, PT, and TT (). Although the TT was strongly correlated with GPIIb/IIIa per platelet (, ), the relationship of SNPs/TT and SNPs/GP (IIb/IIIa) content is not linked. For example, ITGB3 rs4642 was significantly related with the TT (), while the value of GPIIb/IIIa per platelet had no trend among rs4642 genotypes (). The other coagulation indexes were the same. Therefore, the relationship between SNPs and GPIIb/IIIa content cannot be deduced from the correlation of coagulation indexes and SNPs.

Some of the significant correlations between SNPs and platelet function parameters in the present study were not reported previously, which may be due to the reason that SNPs with low MA(F) in the European ancestry were not selected as candidate SNPs in previous studies. For example, the GWAS-genotyping platforms lack the coverage of low frequency/rare variants [33]. Moreover, LD might be another reason, if different genetic patterns (haplotypes) are present in different populations [3].

A possible limitation of the current study is the limited number of subjects. After stratification, the number of subjects in each genotypic group was small, thereby limiting further haplotype association analysis and accession of small effects of an SNP with a small minor allele frequency.

5. Conclusion

In summary, as ethnicity difference might limit the interpretation of the function of SNPs, resequencing the ITGA2B and ITGB3 genes and investigating their functions in the Chinese population are very important. In the present study, nine SNPs were found to associate with indexes of platelet and coagulation haemostasis. Newer studies are needed, particularly, to further assess the clinical importance of the above-discussed SNPs in disease susceptibility and antiplatelet drugs pharmacodynamics. Further studies should pay more attention to the roles of ITGA2B and ITGB3 SNPs in ethnic variations.

Competing Interests

The authors declare that there is no conflict of interests regarding the publication of this paper.

Acknowledgments

This study was supported by grants from the National Natural Science Foundation of China (no. 81273592, no. 81202592, and no. 81373487).

Supplementary Materials

The supplementary table 1 lists the primer sequences used in this study, and the supplementary figure 1 shows the association of coagulation indexes (Platelet Count, Prothrombin Time, Thrombin Time, Partial Thromboplastin Time) with the maximal level of ADP-induced platelet aggregation or GP IIb-IIIa content in healthy volunteers.

  1. Supplementary Material

References

  1. J. J. Calvete, “Clues for understanding the structure and function of a prototypic human integrin: the platelet glycoprotein IIb/IIIa complex,” Thrombosis and Haemostasis, vol. 72, no. 1, pp. 1–15, 1994. View at: Google Scholar
  2. C. L. Wagner, M. A. Mascelli, D. S. Neblock, H. F. Weisman, B. S. Coller, and R. E. Jordan, “Analysis of GPIIb/IIIa receptor number by quantification of 7E3 binding to human platelets,” Blood, vol. 88, no. 3, pp. 907–914, 1996. View at: Google Scholar
  3. A. M. O'Halloran, R. Curtin, F. O'Connor et al., “The impact of genetic variation in the region of the GPIIIa gene, on Pl expression bias and GPIIb/IIIa receptor density in platelets,” British Journal of Haematology, vol. 132, no. 4, pp. 494–502, 2006. View at: Google Scholar
  4. S. Bellucci and J. Caen, “Molecular basis of Glanzmann's Thrombasthenia and current strategies in treatment,” Blood Reviews, vol. 16, no. 3, pp. 193–202, 2002. View at: Publisher Site | Google Scholar
  5. M. Fiore, A. T. Nurden, P. Nurden, and U. Seligsohn, “Clinical utility gene card for: Glanzmann thrombasthenia,” European Journal of Human Genetics, vol. 20, no. 10, p. 1101, 2012. View at: Publisher Site | Google Scholar
  6. C. N. Floyd, B. H. Ellis, and A. Ferro, “The PlA1/A2 polymorphism of glycoprotein IIIa as a risk factor for stroke: a systematic review and meta-analysis,” PLoS ONE, vol. 9, no. 7, Article ID e100239, 2014. View at: Publisher Site | Google Scholar
  7. C. N. Floyd and A. Ferro, “The PlA1/A2 polymorphism of glycoprotein IIIa in relation to efficacy of antiplatelet drugs: a systematic review and meta-analysis,” British Journal of Clinical Pharmacology, vol. 77, no. 3, pp. 446–457, 2014. View at: Publisher Site | Google Scholar
  8. C. N. Floyd, A. Mustafa, and A. Ferro, “The PlA1/A2 polymorphism of glycoprotein IIIa as a risk factor for myocardial infarction: a meta-analysis,” PLoS ONE, vol. 9, no. 7, article e101518, 2014. View at: Publisher Site | Google Scholar
  9. P. J. Newman, R. S. Derbes, and R. H. Aster, “The human platelet alloantigens, PlA1 and PlA2, are associated with a leucine33/proline33 amino acid polymorphism in membrane glycoprotein IIIa, and are distinguishable by DNA typing,” Journal of Clinical Investigation, vol. 83, no. 5, pp. 1778–1781, 1989. View at: Publisher Site | Google Scholar
  10. J.-H. Wu, D.-W. Zhang, X.-L. Cheng, H. Shi, and Y.-P. Fan, “Platelet glycoprotein IIb HPA-3 a/b polymorphism is associated with native arteriovenous fistula thrombosis in chronic hemodialysis patients,” Renal Failure, vol. 34, no. 8, pp. 960–963, 2012. View at: Publisher Site | Google Scholar
  11. M.-P. Li, Y. Xiong, A. Xu et al., “Association of platelet ITGA2B and ITGB3 polymorphisms with ex vivo antiplatelet effect of ticagrelor in healthy Chinese male subjects,” International Journal of Hematology, vol. 99, no. 3, pp. 263–271, 2014. View at: Publisher Site | Google Scholar
  12. Y. Zhang, Y. Han, L. Dong et al., “Genetic variation of ITGB3 is associated with asthma in chinese han children,” PLoS ONE, vol. 8, no. 2, article e56914, 2013. View at: Publisher Site | Google Scholar
  13. S. Simsek, N. M. Faber, P. M. Bleeker et al., “Determination of human platelet antigen frequencies in the Dutch population by immunophenotyping and DNA (allele-specific restriction enzyme) analysis,” Blood, vol. 81, no. 3, pp. 835–840, 1993. View at: Google Scholar
  14. J. Lim, S. Lal, K. C. Ng, K.-S. Ng, N. Saha, and C.-K. Heng, “Variation of the platelet glycoprotein IIIa PIA1/A2 allele frequencies in the three ethnic groups of Singapore,” International Journal of Cardiology, vol. 90, no. 2-3, pp. 269–273, 2003. View at: Publisher Site | Google Scholar
  15. Z. Yiming, J. Shundong, D. Ningzheng, H. Yang, and R. Changgeng, “Measurement of affinity constant of humanized monoclonal antibody 813-F(ab)2 binding to platelets of human macaque and dos,” Suzhou University Journal of Medical Science, vol. 27, no. 1, pp. 8–10, 2007. View at: Google Scholar
  16. P. M. W. Bath and R. J. Butterworth, “Platelet size: measurement, physiology and vascular disease,” Blood Coagulation and Fibrinolysis, vol. 7, no. 2, pp. 157–161, 1996. View at: Publisher Site | Google Scholar
  17. T. J. Kunicki, S. A. Williams, D. J. Nugent, and M. Yeager, “Mean platelet volume and integrin alleles correlate with levels of integrins α iIbβ 3 and α 2β 1 in acute coronary syndrome patients and normal subjects,” Arteriosclerosis, Thrombosis, and Vascular Biology, vol. 32, no. 1, pp. 147–152, 2012. View at: Publisher Site | Google Scholar
  18. K. Shameer, J. C. Denny, K. Ding et al., “A genome- and phenome-wide association study to identify genetic variants influencing platelet count and volume and their pleiotropic effects,” Human Genetics, vol. 133, no. 1, pp. 95–109, 2014. View at: Publisher Site | Google Scholar
  19. R. Qayyum, B. M. Snively, E. Ziv et al., “A meta-analysis and genome-wide association study of platelet count and mean platelet volume in African Americans,” PLoS Genetics, vol. 8, no. 3, Article ID e1002491, 2012. View at: Publisher Site | Google Scholar
  20. N. Soranzo, A. Rendon, C. Gieger et al., “Anovel variant on chromosome 7q22.3 associated with mean platelet volume, counts, and function,” Blood, vol. 113, no. 16, pp. 3831–3837, 2009. View at: Publisher Site | Google Scholar
  21. C. Meisinger, H. Prokisch, C. Gieger et al., “A genome-wide association study identifies three loci associated with mean platelet volume,” American Journal of Human Genetics, vol. 84, no. 1, pp. 66–71, 2009. View at: Publisher Site | Google Scholar
  22. G. C. White II, “The partial thromboplastin time: defining an era in coagulation,” Journal of Thrombosis and Haemostasis, vol. 1, no. 11, pp. 2267–2270, 2003. View at: Publisher Site | Google Scholar
  23. S. Kitchen, A. McCraw, and M. Echenagucia, Diagnosis of Hemophilia and Other Bleeding Disorders: A Laboratory Manual, World Federation of Hemophilia (WFH), Montreal, Canada, 2nd edition, 2010.
  24. G. Hron, S. Eichinger, A. Weltermann, P. Quehenberger, W. M. Halbmayer, and P. A. Kyrle, “Prediction of recurrent venous thromboembolism by the activated partial thromboplastin time,” Journal of Thrombosis and Haemostasis, vol. 4, no. 4, pp. 752–756, 2006. View at: Publisher Site | Google Scholar
  25. N. A. Zakai, T. Ohira, R. White, A. R. Folsom, and M. Cushman, “Activated partial thromboplastin time and risk of future venous thromboembolism,” American Journal of Medicine, vol. 121, no. 3, pp. 231–238, 2008. View at: Publisher Site | Google Scholar
  26. L. M. Houlihan, G. Davies, A. Tenesa et al., “Common variants of large effect in F12, KNG1, and HRG are associated with activated partial thromboplastin time,” The American Journal of Human Genetics, vol. 86, no. 4, pp. 626–631, 2010. View at: Publisher Site | Google Scholar
  27. W. Tang, C. Schwienbacher, L. M. Lopez et al., “Genetic associations for activated partial thromboplastin time and prothrombin time, their gene expression profiles, and risk of coronary artery disease,” American Journal of Human Genetics, vol. 91, no. 1, pp. 152–162, 2012. View at: Publisher Site | Google Scholar
  28. C. I. Jones, S. Bray, S. F. Garner et al., “A functional genomics approach reveals novel quantitative trait loci associated with platelet signaling pathways,” Blood, vol. 114, no. 7, pp. 1405–1416, 2009. View at: Publisher Site | Google Scholar
  29. J. S. Bennett, F. Catella-Lawson, A. R. Rut et al., “Effect of the P1A2 alloantigen on the function of β3-integrins in platelets,” Blood, vol. 97, no. 10, pp. 3093–3099, 2001. View at: Publisher Site | Google Scholar
  30. O. V. Sirotkina, S. G. Khaspekova, A. M. Zabotina, Y. V. Shimanova, and A. V. Mazurov, “Effects of platelet glycoprotein IIb-IIIa number and glycoprotein IIIa Leu33Pro polymorphism on platelet aggregation and sensitivity to glycoprotein IIb-IIIa antagonists,” Platelets, vol. 18, no. 7, pp. 506–514, 2007. View at: Publisher Site | Google Scholar
  31. A. Fuentes, A. Rojas, K. B. Porter, G. Saviello, and W. F. O'Brien, “The effect of magnesium sulfate on bleeding time in pregnancy,” American Journal of Obstetrics and Gynecology, vol. 173, no. 4, pp. 1246–1249, 1995. View at: Publisher Site | Google Scholar
  32. V. V. Yakushkin, I. T. Zyuryaev, S. G. Khaspekova, O. V. Sirotkina, M. Y. Ruda, and A. V. Mazurov, “Glycoprotein IIb-IIIa content and platelet aggregation in healthy volunteers and patients with acute coronary syndrome,” Platelets, vol. 22, no. 4, pp. 243–251, 2011. View at: Publisher Site | Google Scholar
  33. B. J. Grady and M. D. Ritchie, “statistical optimization of pharmacogenomics association studies: key considerations from study design to analysis,” Current Pharmacogenomics and Personalized Medicine, vol. 9, no. 1, pp. 41–66, 2011. View at: Publisher Site | Google Scholar

Copyright © 2016 Qian Xiang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

938 Views | 396 Downloads | 4 Citations
 PDF  Download Citation  Citation
 Download other formatsMore
 Order printed copiesOrder

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19.