Journal of Immunology Research

Journal of Immunology Research / 2020 / Article
Special Issue

Extracellular Matrix and Immune Niches in Human Disease

View this Special Issue

Research Article | Open Access

Volume 2020 |Article ID 8340329 | https://doi.org/10.1155/2020/8340329

Guang-Ang Tian, Chun-Jie Xu, Kai-Xia Zhou, Zhi-Gang Zhang, Jian-Ren Gu, Xue-Li Zhang, Ya-Hui Wang, "MPC1 Deficiency Promotes CRC Liver Metastasis via Facilitating Nuclear Translocation of β-Catenin", Journal of Immunology Research, vol. 2020, Article ID 8340329, 11 pages, 2020. https://doi.org/10.1155/2020/8340329

MPC1 Deficiency Promotes CRC Liver Metastasis via Facilitating Nuclear Translocation of β-Catenin

Guest Editor: Zenghui Teng
Received04 May 2020
Revised09 Jul 2020
Accepted17 Jul 2020
Published08 Aug 2020

Abstract

Accumulating evidence has pointed out that metastasis is the leading cause of death in several malignant tumor, including CRC. During CRC, metastatic capacity is closely correlated with reprogrammed energy metabolism. Mitochondrial Pyruvate Carrier 1 (MPC1), as the carrier of transporting pyruvate into mitochondria, linked the glycolysis and TCA cycle, which would affect the energy production. However, the specific role of MPC1 on tumor metastasis in CRC remains unexplored. Here, by data mining of genes involved in pyruvate metabolism using the TCGA dataset, we found that MPC1 was significantly downregulated in CRC compared to nontumor tissues. Similar MPC1 expression pattern was also found in multiple GEO datasets. IHC staining in both human sample and AOM/DSS induced mouse CRC model revealed significant downregulation of MPC1. What is more, we found that MPC1 expression was gradually decreased in normal tissue, primary CRC, and metastasis CRC. Additionally, poor prognosis emerged in the MPC1 low expression patients, especially in patients with metastasis. Following, functional tests showed that MPC1 overexpression inhibited the motility of CRC cells in vitro and MPC1 silencing enhanced liver metastases in vivo. Furthermore, we uncovered that decreased MPC1 activated the Wnt/β-catenin pathway by promoting nuclear translocation of β-catenin to mediate the expression of MMP7, E-cadherin, Snail1, and myc. Collectively, our data suggest that MPC1 has the potential to be served as a promising biomarker for diagnosis and a therapeutic target in CRC.

1. Introduction

Colorectal carcinoma (CRC), as one of the most common gastrointestinal malignancies, has developed the world’s fourth most deadly cancer with a high rate of incidence and mortality [1, 2]. Liver metastasis, which is the most common form for CRC metastasis, is the leading cause of high mortality for this severe malignancy [2]. However, few clinical prevention and treatment measures could be available for tumor metastasis. Therefore, it is really urgent to develop new biomarkers and explore the underlying mechanism for CRC metastasis, and eventually develop new therapeutic strategies for CRC patients.

During cancer progression, metabolic reprograming with increasing glucose utilization is termed as Warburg affect, which is accompanied by altered pyruvate and mitochondrial metabolism [3]. The fate of pyruvate is the core manifestation to distinguish normal cells and tumor cells through metabolism. In normal cells, pyruvate was used for efficient ATP production directly into mitochondria. However, pyruvate was converted into lactate in cytosol despite of normoxic and hypoxic conditions in cancer cells [4]. This may be due to the impaired process of pyruvate from the cytosol into the mitochondrial matrix, which is a critical metabolic step linking glycolysis and mitochondrial oxidative phosphorylation. The Mitochondrial Pyruvate Carrier (MPC), a multimeric complex containing two distinct proteins MPC1 and MPC2, which is located in the inner mitochondrial membrane, is responsible for efficient mitochondrial pyruvate uptake [5]. Loss of MPC expression or activity blocks pyruvate entry into the TCA cycle, which results in a metabolism switch to increase glycolysis and the compensatory usage of glutamine [6, 7].

Existed studies have reported that MPC1 was related with immunoregulation, stemness, metabolism, cellular morphology, etc. [3, 810]. Currently, the important role of MPC1 was uncovered in several tumors. In CRC and esophageal squamous cell carcinoma, decreased MPC1 results in accelerated aerobic glycolysis and malignant progression [11, 12]. In lung adenocarcinoma, MPC1 deficiency accelerates lung adenocarcinoma progression through the STAT3 pathway [13]. In prostate cancer, MPC1 was reported to be involved in stemness and metabolism which regulated by COUPTFII [14, 15]. In renal cell carcinoma, hypoxia-induced loss of MPC1 enhanced the expression of MMP7 and MMP9 to promote cell invasion [16]. Collectively, these data suggested that MPC1 maybe serves as a suppressor to disrupt tumor malignancy. However, whether MPC1 is involved in CRC metastasis and the underlying mechanisms remain to be illustrated.

In the present study, we figured out the relationship between the MPC1 expression and CRC liver metastasis. We identified that decreased MPC1 was closely correlated with patient’s metastasis, as well as led to poor prognosis. Functionally, MPC1 overexpression could attenuate the migration and invasion capacities of CRC cells both in vitro and in vivo. Mechanically, MPC1 suppressed CRC metastasis through mediating the Wnt/β-catenin signaling. Thus, our finding firstly revealed a critical role of MPC1 in CRC liver metastasis.

2. Materials and Methods

2.1. Data Mining

Seven GEO datasets (GSE21510, GSE5206, GSE20916, GSE9348, GSE89393, GSE67675, and GSE4183) and TCGA were used to analyze the MPC1 expression pattern in CRC. The primary data for TCGA datasets were downloaded https://www.cancer.gov/. The primary data for GEO datasets were downloaded at https://www.ncbi.nlm.nih.gov/geo. The OncoLnc database (http://www.oncolnc.org/) was used to detect the prognostic value of MPC1 in the TCGA cohort.

2.2. Patients and Clinical Specimens

In our study, a total of 392 patients containing paired CRC tissues and adjacent nontumor tissues were enrolled from the Department of Gastrointestinal Surgery, Renji Hospital, School of Medicine, Shanghai Jiao Tong University. Among them, 30 cases of liver metastases were collected. And only 225 cases were available with complete follow-up data for survival analysis. Informed consents were signed by all patients. The research was approved by the Research Ethics Committee of Renji Hospital and carried out in accordance with ethical standards as formulated in the Helsinki Declaration.

2.3. Cell Culture and Cell Transduction

Human CRC cell lines (HCT116, HT29, SW620, RKO, SW480, and Lovo) and mouse CRC cell line MC38 were gained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). All cells were cultured in DMEM medium supplemented with 10% fetal bovine serum and 1% antibiotics at 37°C in a humidified incubator with 5% CO2.

MC38 cells were transfected with lentivirus containing a luciferase reporter plasmid. Stable transfection cells were screened with 5 μg/ml blastisidin for 14 days, which termed MC38-Luc. In addition, one short hairpin RNA (shRNA) sequence against MPC1 was packaged as lentivirus and transfected into MC38-luc cells. Lovo and SW480 were transfected with lentivirus containing full-length human MPC1 cDNA or empty vehicle control. Stable transfection cells were screened under 2 μg/ml puromycin for 14 days and verified by western blot. In those assays, all lentiviral transfections were performed in the presence of 6 μg/ml polybrene.

2.4. Immunohistochemical (IHC)

The protocol of this assay and quantify the MPC1 protein expression level were performed according to previously reported [17]. Primary antibodies used as follows: MMP7 (YT2663, Immunoway), E-cadherin (14472, CST), Snail1 (ab53519, Abcam), and MYC (YP0861, Immunoway).

2.5. Cellular Immunofluorescence

Assays were performed according to the previous description [18]. Briefly, cells were incubated with antibodies against β-catenin (ab32572, Abcam) and incubated with Alexa 488-conjugated secondary antibody (1 : 200). The nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI).

2.6. Western Blotting

Whole-cell lysates or nuclear protein was extracted using a protein extraction buffer (Beyotime, Shanghai, China) or nucleoprotein extraction kit (Sangon Biotech, C500009), respectively. Proteins were resolved by SDS-PAGE and transferred onto nitrocellulose (NC) membranes using standard methods. Primary antibodies used as follows: MPC1 (ab74871, Abcam), β-catenin (ab32572, Abcam), lamin A/C (ab8984, Abcam), and GAPDH (ab9485, Abcam). Species-specific secondary antibodies used as follows: IRDye 680 Goat anti-Mouse IgG (LI-COR) and IRDye 800 Goat anti-rabbit IgG (LI-COR).

2.7. Real-Time PCR

Total RNA was extracted using Trizol (Takara) according to the manufacturer’s instructions. cDNA was synthesized using the PrimeScript reverse transcription-polymerase chain reaction (RT-PCR) kit (Takara). The qPCR was performed using SYBR Green Master Mix (Roche). The 2 CT method was used to analyze the data and GAPDH was used as a loading control. The primer sequences are listed in Table 1.


PrimerSequence 5-3

MMP7 forwardGAGTGAGCTACAGTGGGAACA
MMP7 reverseCTATGACGCGGGAGTTTAACAT
E-cadherin forwardATGAGTGTCCCCCGGTATCTTC
E-cadherin reverseACGAGCAGAGAATCATAAGGCG
Snail1 forwardGTATCCAGAGCTGTTTGGA
Snail1 reverseAACATTTTCCTCCCAGGCC
Myc forwardATCACAGCCCTCACTCAC
Myc reverseACAGATTCCACAAGGTGC
GAPDH forwardCTGGGCTACACTGAGCACC
GAPDH reverseAAGTGGTCGTTGAGGGCAATG

2.8. Liver Metastasis Model

This study was performed in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals and relevant Chinese laws and regulations. The protocol was approved by the Institutional Animal Care and Use Committee (IACUC) of Shanghai Jiao Tong University. The MC38 cells transplanting luciferase-expressing were injected into the spleens of C57BL/6N mice () with a concentration of 106 cells/mouse. Two weeks later, the mice were killed and the liver metastasis tissues were harvested.

2.9. Luciferase Reporter Assay

The protocols of this assay were operated in accordance with previous reported [18]. 100 ng TOP reporter plasmid (Wnt/β-catenin signaling) or 100 ng FOP reporter plasmid (negative control of Wnt/β-catenin signaling) and 10 ng Renilla were mixed and transfected into CRC cells using Lipofectamine 2000. Dual-luciferase reporter assay system (Promega) was used to detect the firefly and Renilla luciferase activities.

3. Statistical Analyses

Data are shown as . SPSS 20.0 (Chicago, IL, USA) and GraphPad Prism 5 software were used to manipulate statistical analyses. Kaplan-Meier method was used to calculate cumulative survival time. The chi-square test or Student’s -test was used for comparison between groups. was considered as statistically significant.

4. Results

4.1. MPC1 Expression Was Aberrantly Decreased in CRC

Pyruvate is a pivotal intermediate in the process of cell metabolism, which connects glycolysis and the TCA cycle. To determine the potential maladjustment genes involved in pyruvate metabolism, which is located in mitochondria, as shown in Table 2, we analyzed the TCGA dataset containing 50 CRC and their normal counterparts. The results showed that multiple genes are significantly upregulated or downregulated in CRC (T) tissues compared to normal colon (N). Notably, MPC1 had a log2 (fold change) less than -1 (Figures 1(a) and 1(b)). As known to us, pyruvate translocation from the cytoplasm to the mitochondria is the first step into the TCA cycle, which needs MPC1/MPC2 heterodimer. In the analysis, no significant change was found in MPC2. Therefore, MPC1 was selected for further study. The expression pattern of MPC1 was further analyzed in five independent GEO datasets (GSE21510, GSE5206, GSE20916, GSE9348, and GSE4183). Consistently, we found that MPC1 was downregulated with statistical difference in CRC tissues (Figure 1(c)) and inflammatory tissue (Supplementary Figure 1) in comparison to their normal counterparts. Meanwhile, we found decreased MPC1 expression in human CRC tissues compared to their normal counterparts (Figure 1(d)). In addition, a similar phenomenon was revealed in AOM/DSS induced mouse CRC models (Figure 1(e)). Then, we evaluated the protein level of MPC1 used a tissue microarray containing 392 matching cancer and corresponding adjacent nontumor tissues which subjected IHC staining. The expression of MPC1 was scored as “-, +, ++, +++” based on the staining area and intensity (Figure 1(f)). We found that more lower MPC1 expression (score as “-” and “+”) was presented in CRC tissues (Figure 1(g)). Overall, these results revealed that MPC1 was disrupted during CRC.


GeneDescriptionLocation

PDHA1Pyruvate dehydrogenase (lipoamide) alpha 1Mitochondrion matrix.
PDHBPyruvate dehydrogenase (lipoamide) betaMitochondrion matrix.
PDK4Pyruvate dehydrogenase kinase, isozyme 4Mitochondrion matrix.
PDHXPyruvate dehydrogenase complex, component XMitochondrion matrix.
MPC2Mitochondrial pyruvate carrier 2Mitochondrion inner membrane
PDK2Pyruvate dehydrogenase kinase, isozyme 2Mitochondrion matrix.
PDK1Pyruvate dehydrogenase kinase, isozyme 1Mitochondrion matrix.
PDK3Pyruvate dehydrogenase kinase, isozyme 3Mitochondrion matrix.
MPC1Mitochondrial pyruvate carrier 1Mitochondrion inner membrane
PCPyruvate carboxylaseMitochondrion matrix.
PDP1Pyruvate dehydrogenase phosphatase catalytic subunit 1Mitochondrion matrix.
PDPRPyruvate dehydrogenase phosphatase regulatory subunitMitochondrion matrix.
PDHA2Pyruvate dehydrogenase (lipoamide) alpha 2Mitochondrion matrix.
PDP2Pyruvate dehydrogenase phosphatase catalytic subunit 2Mitochondrion matrix.
PKLRPyruvate kinase, liver and RBCMitochondrion

4.2. Decreased MPC1 Enhanced Tumor Metastasis Capability and Predicated Poor Prognosis in CRC

It is well known that CRC is one of the most malignant tumors given its strong metastasis ability, so we tried to figure out whether the MPC1 expression was correlated with metastasis. We found that lower MPC1 expression was closely correlated with metastasis (), lymph node invasion (), and TNM stage (), which revealed by the analysis between the clinical significance and MPC1 expression in CRC (Table 3). Next, to illuminate the expression pattern of MPC1 in different process of CRC, data mining was carried out by two independent GEO datasets (GSE21510 and GSE89393), which contained normal tissue, primary CRC, and metastatic lesion in the liver (M-CRC). As shown in Figures 2(a) and 2(b), MPC1 expression was gradually downregulated in patients with an increase in metastasis ability. A similar result was found in mice cells CT26 with high liver metastasis (HM-CT26) or poor liver metastasis (PM-CT26) (Figure 2(c)), which isolated by in vivo selection in an orthotopic mouse model of colon cancer metastasis to the liver. Further analysis showed that MPC1 protein expression was gradually downregulated in normal tissue, primary CRC, and liver metastasis CRC (CRLM) tissues (Figure 2(d)). Furthermore, survival analysis showed that patients with lower MPC1 expression had a worse outcome compared to the patients with higher MPC1 expression using the TCGA cohort (Figure 2(e)) and Ren Ji cohort (Figure 2(f)). Additionally, among patients with metastasis, worse prognosis was emerged in the MPC1 low cases (Figure 2(g)), while no significant association was observed in patients without metastasis (Figure 2(h)).


Clinicopathological featureExpression of MPC1
LowHigh value ( test)

Age (years)
 <6095960.766
 ≥6010398
Gender
 Male1121200.287
 Female8674
Metastasis
 Yes52300.009
 No146164
Lymph node invasion
 Yes106750.003
 No91119
Tumor size
 <5 cm991080.388
 ≥5 cm9486
TNM stage
 I15200.001
 II5892
 III7452
 IV5130
KRAS mutation
 Mutation33400.246
 No mutation5143

4.3. MPC1 Overexpression Impaired CRC Cells Motility Both In Vitro and In Vivo

To evaluate the role of MPC1 on the motility of CRC cells, the transwell assay was performed. Firstly, we examined low MPC1 protein expression in human and high MPC1 protein expression in mouse MC38 CRC cells by western blot (Figure 3(a)). MPC1-overexpressing stable cell lines were established using a lentivirus carrying the MPC1 gene in Lovo and SW480 cells. And the overexpression efficiency was confirmed by immunoblots (Figure 3(b)). MPC1 knockdown in Luc-MC38 cells were established and verified by WB (Figure 3(c)). MPC1 overexpression exhibited significantly weaker migration and invasion ability than the control cells in both Lovo (Figure 3(d)) and SW480 (Figure 3(e)) cells. Following, the liver metastasis model of CRC was established by spleen orthotopically injecting MC38 cells transplanting luciferase-expressing, which would simulate MC38 metastasis to the liver through splenic vein-portal vein. The results revealed that the MPC1 knockdown promoted MC38 cells metastasis to the liver through detecting the luminescence intensity monitored by bioluminescence imaging (Figure 3(f)). Notably, the number of metastatic liver nodules in the MPC1 silencing group was smaller than that in the control group (Figure 3(g)). Histological examination also proved that MPC1 knockdown decreased the metastatic potential of CRC in vivo (Figure 3(g)).

4.4. Decreased MPC1 Activated the Wnt/β-Catenin Pathway by Promoting Nuclear Translocation of β-Catenin

To further explore the underlying mechanism of MPC1-mediated inhibition of CRC metastasis, the TCGA database was used to perform GSEA analysis. The results indicated that MPC1 was involved in the Wnt/β-catenin signaling when set the mRNA expression median as a cutoff (Figure 4(a)). And dual-luciferase reporter gene assay revealed that MPC1 overexpression obviously inhibited the activity of Wnt/β-catenin pathway (Figure 4(b)), which confirmed the result above. We then tested the distribution changes of β-catenin in nuclear and cytoplasmic, which was a crucial step in Wnt/β-catenin pathway. As shown in Figure 4(c), no significant difference was emerged in the total amount of β-catenin between MPC1 overexpression cells and the control cells (Figure 4(c)). However, obviously decreased distribution of nuclear β-catenin was presented in MPC1 overexpression cells compared to that in the control cells, as revealed by the stronger gray corresponding to β-catenin (Figures 4(c) and 4(d)). Consistently, immunofluorescence (IF) staining showed that MPC1 overexpression weakened nuclear β-catenin localization in both Lovo and SW480 cells when compared to control cells (Figures 4(e) and 4(f)). A Similar phenomenon was observed in mouse liver metastasis tissues by IHC (Figure 4(g)). Following, qPCR analyses displayed some downstream target genes of β-catenin, such as MMP7, E-cadherin, Snail1, and MYC. Obviously increased in E-cadherin and decreased in MMP7, Snail1, and MYC were observed after the MPC1 overexpression in both Lovo and SW480 cells compared to that in the control cells (Figures 4(h) and 4(i)). Meanwhile, the opposite trend was observed in MC38 cell after MPC1 knockdown (Figure 4(j)), and similar results were observed in mouse liver tissue detected by IHC (Figures 4(k)4(n)). Taken together, the data above indicated that MPC1 mediated CRC cell metastasis through the Wnt/β-catenin pathway.

5. Discussion

Accumulating evidences have shown that reprogrammed energy metabolism conduces to the tumor malignant properties, including enhanced CRC liver metastatic capacity [1921]. Mitochondria, as the primary site of energy production, regulate the pyruvate metabolism under both physiologic and pathologic conditions. The first step of the TCA cycle is mediated by MPC, which transports pyruvate into mitochondrial from cytoplasm [3]. In the beginning, TCGA was used to analyze the relative genes involved in pyruvate metabolism, which is located in mitochondria. The results revealed that MPC1 expression was significantly downregulated in CRC tissues. Meanwhile, the GEO datasets analysis, as well as, IHC staining on CRC patients’ tissue and mouse models confirmed this trend. These phenomena may indicate that loss of MPC activity enhanced tumorigenic glucose utilization by blocking mitochondrial pyruvate uptake and oxidation. Interestingly, in the course of data analysis, we found that the expression of MPC1 was decreased at the stage of intestinal inflammation, which was not different from that in tumor tissue. MPC1 has been reported to be involved in immune regulation of peripheral T cell homeostasis through metabolic regulation [8]. And a decrease in MPC1 was found at the earliest stages of CRC [22]. Hence, we suspect that MPC1 is involved in bowel inflammation to tumorigenesis. And more studies need to be devised to illustrate this process.

Following, in the analysis between the clinical significance and MPC1 expression in CRC, we found that MPC1 expression was especially correlated with metastasis. Inspired by this, we detected the MPC1 expression pattern in normal tissue, primary CRC, and metastasis CRC by GEO datasets and patients’ tissue. All results revealed that gradually downregulated MPC1 was in patients with an increase in metastasis ability. Survival analysis indicated that worse outcome was presented in patients with lower MPC1 expression, especially in patients with metastasis. Additionally, function assays verified that MPC1 overexpression could attenuate the migration and invasion capacities of CRC cells in vitro and MPC1 knockdown could enhance the metastasis capacity in vivo. And existing studies have revealed that the MPC1 was participated in metastatic dissemination of PGC1α-transduced cholangiocarcinoma through elevating reactive oxygen species (ROS) production [10]. Besides, MPC inhibitor UK5099 treatment could trigger strong invasive capacity through blocking pyruvate translocation into the mitochondria so as to attenuate mitochondrial oxidative phosphorylation and trigger aerobic glycolysis [12]. These phenomena together with our results indicate that MPC1 could act as a tumor suppressor through inhibiting tumor metastasis. And existing studies have shown that MPC1 could alter the maintenance and fate of stem cells through regulating cancer metabolism in CRC [11]. However, the relationship between the metabolism and tumor metastasis regulated by MPC1 was not being mentioned. Thus, further evidence should be received to confirm this.

Subsequently, the underlying mechanism of MPC1 in regulating metastasis was explored. For this purpose, GSEA analysis was performed. The results indicated that MPC1 was involved in the Wnt/β-catenin signaling. The next series of experiments also confirmed that MPC1 could mediate the WNT/β-catenin pathway by redistribution of β-catenin. Previous reports showed that cytoplasmic β-catenin phosphorylated in N-terminally localized to sites of cell-cell contact is associated with E-cadherin and was required for intact cell-cell adhesions, without any change detected in the levels of total β-catenin [2325]. Simultaneously, cell–cell adhesion based on cadherin binding with β-catenin limited Wnt signals [24]. In addition, β-catenin was reported to interact with USP9x to inhibit the degradation of β-catenin through the deubiquitination of β-catenin in breast cancer [26]. A constitutive IRS1 and β-catenin protein interaction activated MYC expression in Acute Lymphoblastic Leukemia Cells [27]. In HCC, β-catenin was reported to interact with Yap1 to lead to rapid tumorigenesis [28]. Hence, it is reasonable to guess that accumulated cytoplasmic β-catenin maybe crosstalk with other genes or involved in other biological processes. What is more, some downstream target genes of β-catenin, such as MMP7, E-cadherin, Snail1, and myc, were changed in expression. As known to us, MMP-7 is a member of the proteolytic enzyme family, which promotes the invasion and metastasis of tumor cells by degrading the basement membrane and extracellular matrix [29]. And previous studies had evidenced for involvement of MMP-7 activation in colorectal cancer liver metastases [30, 31]. E-cadherin and Snail1 were considered as the epithelial-mesenchymal transition (EMT) marker, which was involved in metastasis of malignant tumor [32]. Moreover, E-cadherin was reported to be involved in cell-cell junction to regulate cancer invasion and metastasis [33, 34]. And the GSEA analysis also revealed that MPC1 could affect the cell-cell contacts (data not shown). As described previously, MMP-7 could facilitate morphological transition by cleaving E-cadherin [35]. The communication between the cells is disrupted when E-cadherin was shredded, leading to destructed cell adhesion and induction of EMT, followed by increased cell migration [36]. Inspired by this, we assumed that MPC1 could mediate tumor cell motility through affecting MMP7 activity, cell-cell contacts, and EMT. However, further studies need to be performed to clarify the detailed underlying mechanisms.

6. Conclusions

In conclusion, we firstly demonstrated that decreased MPC1 was closely correlated with patient’s metastasis, as well as led to poor outcome. Moreover, MPC1-driven nuclear translocation of β-catenin contributed to CRC cell motility. This means that MPC1 has the potential to be a diagnostic biomarker and therapeutic target for metastasis patients.

Abbreviations

CRC:Colorectal carcinoma
MPC:Mitochondrial pyruvate carrier
EMT:Epithelial-mesenchymal transition
GSEA:Gene set enrichment analysis.

Data Availability

The data used to support the findings of this study are available from the corresponding author upon request.

Conflicts of Interest

All authors declare no conflicts of interest.

Authors’ Contributions

Ya-Hui Wang and Guang-Ang Tian conceived and designed the study. Chun-Jie Xu and Kai-Xia Zhou obtained and organized the data. Guang-Ang Tian analyzed the data. Zhi-Gang Zhang and Jian-Ren Gu contributed reagents/materials/analysis tools. Xue-Li Zhang and Guang-Ang Tian wrote the manuscript. Guang-Ang Tian, Chun-Jie Xu, and Kai-Xia Zhou contributed equally to this work.

Acknowledgments

This work was supported by the National Natural Science Foundation of China (No. 81672358 to Zhi-Gang Zhang) and the Natural Science Foundation of Shanghai (No. 18ZR1436900 to Xueli-Li Zhang).

Supplementary Materials

“Supplementary Figure 1: expression analysis of MPC1 in normal, IBD, and tumor tissues using the GSE4183 dataset. One-way ANOVA was used to analyze the statistical differences between IBD, adenoma, and CRC tissues. ns: No significance. Student’s -test, , , ). (Supplementary Materials)

References

  1. H. Brody, “Colorectal cancer,” Nature, vol. 521, no. 7551, 2015. View at: Publisher Site | Google Scholar
  2. R. L. Siegel, K. D. Miller, S. A. Fedewa et al., “Colorectal cancer statistics, 2017,” CA: A Cancer Journal for Clinicians, vol. 67, no. 3, pp. 177–193, 2017. View at: Publisher Site | Google Scholar
  3. A. J. Rauckhorst and E. B. Taylor, “Mitochondrial pyruvate carrier function and cancer metabolism,” Current Opinion in Genetics & Development, vol. 38, pp. 102–109, 2016. View at: Publisher Site | Google Scholar
  4. M. G. Vander Heiden, L. C. Cantley, and C. B. Thompson, “Understanding the Warburg effect: the metabolic requirements of cell proliferation,” Science, vol. 324, no. 5930, pp. 1029–1033, 2009. View at: Publisher Site | Google Scholar
  5. S. Herzig, E. Raemy, S. Montessuit et al., “Identification and functional expression of the mitochondrial pyruvate carrier,” Science, vol. 337, no. 6090, pp. 93–96, 2012. View at: Publisher Site | Google Scholar
  6. C. Yang, B. Ko, C. T. Hensley et al., “Glutamine oxidation maintains the TCA cycle and cell survival during impaired mitochondrial pyruvate transport,” Molecular Cell, vol. 56, no. 3, pp. 414–424, 2014. View at: Publisher Site | Google Scholar
  7. T. Bender, G. Pena, and J. C. Martinou, “Regulation of mitochondrial pyruvate uptake by alternative pyruvate carrier complexes,” The EMBO Journal, vol. 34, no. 7, pp. 911–924, 2015. View at: Publisher Site | Google Scholar
  8. A. G. Ramstead, J. A. Wallace, S.-H. Lee et al., “Mitochondrial pyruvate carrier 1 promotes peripheral T cell homeostasis through metabolic regulation of thymic development,” Cell Reports, vol. 30, no. 9, pp. 2889–2899.e6, 2020. View at: Publisher Site | Google Scholar
  9. X. Zhou, Z. J. Xiong, S. M. Xiao et al., “Overexpression of MPC1 inhibits the proliferation, migration, invasion, and stem cell-like properties of gastric cancer cells,” Oncotargets and Therapy, vol. 10, pp. 5151–5163, 2017. View at: Publisher Site | Google Scholar
  10. D. Li, C. Wang, P. Ma et al., “PGC1α promotes cholangiocarcinoma metastasis by upregulating PDHA1 and MPC1 expression to reverse the Warburg effect,” Cell Death & Disease, vol. 9, no. 5, 2018. View at: Publisher Site | Google Scholar
  11. J. C. Schell, K. A. Olson, L. Jiang et al., “A role for the mitochondrial pyruvate carrier as a repressor of the Warburg effect and colon cancer cell growth,” Molecular Cell, vol. 56, no. 3, pp. 400–413, 2014. View at: Publisher Site | Google Scholar
  12. Y. Li, X. Li, Q. Kan et al., “Mitochondrial pyruvate carrier function is negatively linked to Warburg phenotype in vitro and malignant features in esophageal squamous cell carcinomas,” Oncotarget, vol. 8, no. 1, pp. 1058–1073, 2017. View at: Publisher Site | Google Scholar
  13. H. Zou, Q. Chen, A. Zhang et al., “MPC1 deficiency accelerates lung adenocarcinoma progression through the STAT3 pathway,” Cell Death & Disease, vol. 10, no. 3, 2019. View at: Publisher Site | Google Scholar
  14. L. Wang, M. Xu, J. Qin et al., “MPC1, a key gene in cancer metabolism, is regulated by COUPTFII in human prostate cancer,” Oncotarget, vol. 7, no. 12, pp. 14673–14683, 2016. View at: Publisher Site | Google Scholar
  15. Y. Zhong, X. Li, D. Yu et al., “Application of mitochondrial pyruvate carrier blocker UK5099 creates metabolic reprogram and greater stem-like properties in LnCap prostate cancer cells in vitro,” Oncotarget, vol. 6, no. 35, pp. 37758–37769, 2015. View at: Publisher Site | Google Scholar
  16. X. P. Tang, Q. Chen, Y. Li et al., “Mitochondrial pyruvate carrier 1 functions as a tumor suppressor and predicts the prognosis of human renal cell carcinoma,” Laboratory Investigation, vol. 99, no. 2, pp. 191–199, 2019. View at: Publisher Site | Google Scholar
  17. G. A. Tian, C. C. Zhu, X. X. Zhang et al., “CCBE1 promotes GIST development through enhancing angiogenesis and mediating resistance to imatinib,” Scientific Reports, vol. 6, no. 1, article 31071, 2016. View at: Publisher Site | Google Scholar
  18. C. Xu, G. Tian, C. Jiang et al., “NPTX2 promotes colorectal cancer growth and liver metastasis by the activation of the canonical Wnt/β-catenin pathway via FZD6,” Cell Death & Disease, vol. 10, no. 3, 2019. View at: Publisher Site | Google Scholar
  19. C. Soydal, N. O. Kucuk, D. Balci, E. Gecim, S. Bilgic, and A. H. Elhan, “Prognostic importance of the presence of early metabolic response and absence of extrahepatic metastasis after selective internal radiation therapy in colorectal cancer liver metastasis,” Cancer Biotherapy & Radiopharmaceuticals, vol. 31, no. 9, pp. 342–346, 2016. View at: Publisher Site | Google Scholar
  20. Z. Wu, D. Wei, W. Gao et al., “TPO-induced metabolic reprogramming drives liver metastasis of colorectal cancer CD110+ tumor-initiating cells,” Cell Stem Cell, vol. 17, no. 1, pp. 47–59, 2015. View at: Publisher Site | Google Scholar
  21. Q. He, H. Zhang, S. Yao et al., “A study on relationship between metabolic syndrome and colorectal cancer,” Journal of BUON, vol. 23, no. 5, pp. 1362–1368, 2018. View at: Google Scholar
  22. C. L. Bensard, D. R. Wisidagama, K. A. Olson et al., “Regulation of tumor initiation by the mitochondrial pyruvate carrier,” Cell Metabolism, vol. 31, no. 2, pp. 284–300.e7, 2020. View at: Publisher Site | Google Scholar
  23. M. C. Faux, J. L. Coates, N. J. Kershaw, M. J. Layton, and A. W. Burgess, “Independent interactions of phosphorylated β-catenin with E-cadherin at cell-cell contacts and APC at cell protrusions,” PLoS One, vol. 5, no. 11, article e14127, 2010. View at: Publisher Site | Google Scholar
  24. M. T. Maher, A. S. Flozak, A. M. Stocker, A. Chenn, and C. J. Gottardi, “Activity of the β-catenin phosphodestruction complex at cell–cell contacts is enhanced by cadherin-based adhesion,” The Journal of Cell Biology, vol. 186, no. 2, pp. 219–228, 2009. View at: Publisher Site | Google Scholar
  25. S. Roura, S. Miravet, J. Piedra, A. García de Herreros, and M. Duñach, “Regulation of E-cadherin/catenin association by tyrosine phosphorylation,” Journal of Biological Chemistry, vol. 274, no. 51, pp. 36734–36740, 1999. View at: Publisher Site | Google Scholar
  26. W. Ouyang, S. Zhang, B. Yang et al., “β-catenin is regulated by USP9x and mediates resistance to TRAIL-induced apoptosis in breast cancer,” Oncology Reports, vol. 35, no. 2, pp. 717–724, 2016. View at: Publisher Site | Google Scholar
  27. J. C. Fernandes, A. P. N. Rodrigues Alves, J. A. Machado-Neto et al., “IRS1/β-catenin axis is activated and induces MYC expression in acute lymphoblastic leukemia cells,” Journal of Cellular Biochemist, vol. 118, no. 7, pp. 1774–1781, 2017. View at: Publisher Site | Google Scholar
  28. J. Tao, D. F. Calvisi, S. Ranganathan et al., “Activation of β-catenin and Yap1 in human hepatoblastoma and induction of hepatocarcinogenesis in mice,” Gastroenterology, vol. 147, no. 3, pp. 690–701, 2014. View at: Publisher Site | Google Scholar
  29. C. Gialeli, A. D. Theocharis, and N. K. Karamanos, “Roles of matrix metalloproteinases in cancer progression and their pharmacological targeting,” The FEBS Journal, vol. 278, no. 1, pp. 16–27, 2011. View at: Publisher Site | Google Scholar
  30. Z. S. Zeng, W. P. Shu, A. M. Cohen, and J. G. Guillem, “Matrix metalloproteinase-7 expression in colorectal cancer liver metastases: evidence for involvement of MMP-7 activation in human cancer metastases,” Clinical Cancer Research, vol. 8, no. 1, pp. 144–148, 2002. View at: Google Scholar
  31. Y. J. Fang, Z. H. Lu, G. Q. Wang et al., “Elevated expressions of MMP7, TROP2, and survivin are associated with survival, disease recurrence, and liver metastasis of colon cancer,” International Journal of Colorectal Disease, vol. 24, no. 8, pp. 875–884, 2009. View at: Publisher Site | Google Scholar
  32. M. Saitoh, “Involvement of partial EMT in cancer progression,” Journal of Biochemistry, vol. 164, no. 4, pp. 257–264, 2018. View at: Publisher Site | Google Scholar
  33. W. K. Kim, Y. Kwon, M. Jang et al., “β-catenin activation down-regulates cell-cell junction-related genes and induces epithelial-to-mesenchymal transition in colorectal cancers,” Scientific Reports, vol. 9, no. 1, article 18440, 2019. View at: Publisher Site | Google Scholar
  34. M. Canel, A. Serrels, M. C. Frame, and V. G. Brunton, “E-cadherin-integrin crosstalk in cancer invasion and metastasis,” Journal of Cell Science, vol. 126, no. 2, pp. 393–401, 2013. View at: Publisher Site | Google Scholar
  35. V. Noe, B. Fingleton, K. Jacobs et al., “Release of an invasion promoter E-cadherin fragment by matrilysin and stromelysin-1,” Journal of Cell Science, vol. 114, Part 1, pp. 111–118, 2001. View at: Google Scholar
  36. T. Maretzky, K. Reiss, A. Ludwig et al., “ADAM10 mediates E-cadherin shedding and regulates epithelial cell-cell adhesion, migration, and beta-catenin translocation,” Proceedings of the National Academy of Sciences of the United States of America, vol. 102, no. 26, pp. 9182–9187, 2005. View at: Publisher Site | Google Scholar

Copyright © 2020 Guang-Ang Tian et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views271
Downloads312
Citations

Related articles

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.